Labshake search
Citations for Thermo Fisher :
1 - 50 of 283 citations for pcDNA5 FRT since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... pcDNA5/FRT or pcDNA5/FRT/TO vectors (ThermoFisher Scientific) were used for protein expression in mammalian cells via transient transfection or for stable cell line generation ...
-
bioRxiv - Molecular Biology 2021Quote: ... Connie Cepko)52 into pCDNA5/FRT (Thermofisher), and the sgRNAs for this reporter were DSB-H ...
-
bioRxiv - Cell Biology 2023Quote: ... into pcDNA5/FRT/TO (Invitrogen). Plasmids encoding an ER-targeting signal sequence fused to an RFP followed by a KDEL ER-retention signal (RFP-KDEL ...
-
bioRxiv - Cell Biology 2024Quote: ... pcDNA5/FRT/TO (Thermo Fisher) constructs expressing NIX or variants were co-transfected with pOG44 into HeLa-T-rex Flp-in cells mtKeima cells to generate inducible cell lines using Flippase (Flp ...
-
bioRxiv - Cell Biology 2024Quote: ... and pCDNA5/FRT/TO (Invitrogen) by conventional molecular cloning.
-
bioRxiv - Cell Biology 2023Quote: ... pcDNA5-FRT-TO (ThermoFisher Cat # V652020) was digested by BamHI ...
-
bioRxiv - Bioengineering 2023Quote: pcDNA5/FRT (Thermo Fisher Scientific, USA) mammalian expression vector was used for construction of the rDNA ...
-
bioRxiv - Cell Biology 2024Quote: ... or pcDNA5/FRT/TO (Thermo Fisher). The fluorescent reporter constructs were based either on pEGFP or pcDNA5/FRT/TO vectors containing a EGFP-P2A-mCherry cassette ...
-
bioRxiv - Cell Biology 2022Quote: A pcDNA5/FRT/TO vector (ThermoFisher Scientific) was used for transient expression and a pcDNA5/FRT vector (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... pcDNA5/FRT/TO (Invitrogen, Carlsbad, CA, USA); bacterial expression vectors ...
-
bioRxiv - Synthetic Biology 2020Quote: ... ORFs were inserted into pcDNA5/FRT (Invitrogen), which allows targeted integration of the transgenes into the host genome ...
-
bioRxiv - Biophysics 2024Quote: ... with pcDNA5/FRT/TO (Thermo Fisher Scientific) containing p53 family isoforms ...
-
bioRxiv - Cell Biology 2023Quote: All mammalian plasmids were derived from pCDNA5/FRT/TO-EGFP-IRES, a previously modified version (Krenn et al, 2012) of the pCDNA5/FRT/TO vector (Invitrogen). To generate N-terminally-tagged EGFP-CENP-E constructs ...
-
bioRxiv - Molecular Biology 2024Quote: ... hsINTS10 or GFP was cloned into the pcDNA5/FRT/TO/n2SC or pcDNA5/FRT/TO/c2SC vector (Thermo Fisher Scientific) encoding for a tandem StrepII tag followed by a calmodulin binding peptide (CBP ...
-
bioRxiv - Biochemistry 2020Quote: Human AKAP95 cDNA in pcDNA5/FRT/TO (Invitrogen) with an N-terminal FlAG-HA-(FH- ...
-
bioRxiv - Biochemistry 2020Quote: ... a derivative of pcDNA5 FRT/TO (Thermo Fisher).
-
bioRxiv - Biophysics 2024Quote: ... then transfected with pcDNA5/FRT plasmids (Invitrogen, #V601020) expressing either enhanced green fluorescent protein (EGFP ...
-
bioRxiv - Cell Biology 2024Quote: ... Amplicons and pcDNA5/FRT/TO (Thermo Fisher Scientific) were digested with appropriate enzymes ...
-
bioRxiv - Immunology 2021Quote: Combinations of TLRs were cloned into pcDNA5/FRT (Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... FLAG-MHC202 was subcloned into pcDNA5/FRT/TO (Invitrogen). Myc-tagged HCMV strain AD169 US11 (UniProt ID P09727 ...
-
bioRxiv - Molecular Biology 2022Quote: ... rigor-2xmNeongreen was subcloned into pCDNA5/FRT/TO (Invitrogen) via Gibson Assembly using the primer set ‘5-GCTCGGATCCACTAG TCCAGTGTGGTGGAATTCTGCAGATGCCACCATGGCGGACCT-3’ and 5’-ACGGGCCCTCT AGACTCGAGCGGCCGCCACTGTGCTGGATGCGGCCGCTTACTTGTACAG-3’ ...
-
bioRxiv - Cell Biology 2024Quote: ... Life Technologies and cloned into pcDNA5/FRT/TO (Invitrogen) expression vector containing YFP resulting in the indicated YFP fusion proteins ...
-
bioRxiv - Cancer Biology 2021Quote: ... was cloned into plasmid pcDNA5/FRT/TO (Thermo Fisher Scientific) bearing an mCherry and mNeon tandem fluorescent tag (tFT ...
-
bioRxiv - Biochemistry 2020Quote: ... a modified version of pcDNA5-FRT/TO (Thermo Fisher Scientific). The CDS of NLS was exchanged against the CDS of human CENP-C-1-943 using BamHI and XhoI ...
-
bioRxiv - Biochemistry 2023Quote: ... Life Technologies and cloned into the pcDNA5/FRT/TO (Invitrogen) expression vector containing YFP resulting in YFP-ARPP19 fusion proteins ...
-
bioRxiv - Cell Biology 2023Quote: ... Mammalian expression constructs were made using pcDNA5/FRT/TO (Invitrogen) modified to encode EGFP- ...
-
Proteolytic cleavage of the extracellular domain affects signaling of parathyroid hormone receptor 1bioRxiv - Pharmacology and Toxicology 2022Quote: ... All constructs were subcloned into pcDNA5/FRT vector (Thermo Fisher Scientific) using the restriction sites EcoRI and ApaI and verified by sequencing.
-
bioRxiv - Cell Biology 2022Quote: ... Mammalian expression constructs were made using pcDNA5/FRT/TO vectors (Invitrogen), modified to encode the EGFP- or mCherry-reading frames ...
-
bioRxiv - Biochemistry 2022Quote: ... the gene was cloned into the pcDNA5-FRT-TO vector (Invitrogen) with an N-terminal eGFP-tag ...
-
bioRxiv - Molecular Biology 2022Quote: ... or pcDNA5/FRT/TO-3XFL-ZFR and pOG44 plasmids (ThermoFisher Scientific) with TurboFect transfection reagent according to the manufacturer’s protocol (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... CDC20 expression constructs were made using pcDNA5/FRT/TO vectors (Invitrogen) modified to encode the EGFP or FLAG reading frames ...
-
bioRxiv - Genomics 2021Quote: ... and isothermal assembly (90) into the pcDNA5/FRT/TO backbone (ThermoFisher), followed by site-directed mutagenesis to generate the four CSDE1 isoforms (UniprotKB O75534 1 through 4) ...
-
bioRxiv - Biophysics 2022Quote: ... the vector backbone was amplified from the pcDNA5-FRT plasmid (Invitrogen), the stdMCP-stdGFP fragment was amplified from the pUbC-NLS-HA-stdMCP-stdGFP plasmid (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... SUN2 cDNAs were cloned into the pcDNA5-FRT-TO plasmid (Invitrogen). For CTDNEP1-rescue experiments a lentiviral vector was used with the expression of CTDNEP1 being driven by the EF-1α promoter ...
-
bioRxiv - Cell Biology 2022Quote: ... and FLAG-CUL4B and mutants in pcDNA5/FRT/TO vector (Invitrogen).
-
bioRxiv - Cell Biology 2024Quote: ... cDNA was inserted into a pcDNA5-FRT-TO-based vector (Invitrogen) modified to contain N-terminal Myc::EGFP::TEV::S-peptide ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cDNAs were cloned into the pcDNA5-FRT-TO vector (Invitrogen) and plasmids were transfected into U2OS Flp-In T-REx cells together with the plasmid pOG44 (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... This backbone was derived from pcDNA5/FRT/TO vector (Life Technologies) with modified MCS ...
-
bioRxiv - Cell Biology 2020Quote: Astrin mutant expression constructs were made using pcDNA5/FRT/TO vectors (Invitrogen) modified to encode the EGFP or FLAG reading frames ...
-
bioRxiv - Molecular Biology 2020Quote: ... These PCR products were inserted into a pcDNA5/FRT/TO vector (Invitrogen) via the HindIII and BamHI sites by Gibson assembly (New England Biolabs) ...
-
bioRxiv - Cell Biology 2022Quote: ... was used for transient expression and a pcDNA5/FRT vector (ThermoFisher Scientific) for stable cell line establishment in mammalian cells ...
-
bioRxiv - Immunology 2021Quote: ... by digestion with KpnI and XhoI and integrated into pcDNA5/FRT (Invitrogen), cut with KpnI and PspOMI ...
-
bioRxiv - Cell Biology 2020Quote: ... pcDNA5/FRT/TO constructs described above were co-transfected with pOG44 (Invitrogen) into Flp-In Hek293 T-REx cells (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... and this construct was inserted into pcDNA5/FRT/TO (Thermo Fisher; V652020) to generate pcDNA5-GalNAc-T2-GFP ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and subcloned into the expression vector (pcDNA5/FRT/TO; Thermo Fisher Scientific). Cell lines were maintained in cell-culture treated polystyrene dishes at 37°C in a 5% CO2 atmosphere in growth media composed of DMEM media containing 10% FBS ...
-
bioRxiv - Biochemistry 2022Quote: ... cDNAs were cloned into pcDNA5/FRT/TO vector (Life Technologies, V6520–20) or pBABE-puro vector (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... and pcDNA5-FRT-TO-Su9-AsCas12a using Lipofectamine 2000 transfection reagent (Invitrogen). Successful integration of the gene was monitored by antibiotic selection with hygromycin B (75 μg/mL ...
-
bioRxiv - Biophysics 2024Quote: ... the fusion construct was subcloned into a pcDNA5/FRT/TO vector (Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... Plasmids based on the pcDNA5/FRT/TO vector backbone (Thermo Fisher Scientific) were used for the generation of Flp-In T-REx cell lines and the transient overexpression in mammalian cells ...
-
bioRxiv - Cell Biology 2022Quote: ... RPE-1 FRT/TO CCNB1+/+ cell line was transfected with pcDNA5-FRT/TO-Cdk1-alpha-mScarlet and pOG44 (Invitrogen) using a 1:5 ratio ...