-
No products found
because this supplier's products are not listed.
Jakob Ankerhold, et al.,
bioRxiv - Immunology 2021
Quote:
... 3 μg of pIRES-eGFP plasmid DNA (Addgene) were digested with 250 U of Benzonase ...
-
No products found
because this supplier's products are not listed.
Margarida Moura, et al.,
bioRxiv - Cell Biology 2024
Quote:
... The constructs EGFP-CYCLIN BWT and EGFP-CYCLINNDG (Δ90 cyclinB) cloned in the pMT-EGFP-C vector (Invitrogen, Carlsbad, CA) were a gift from Helder Maiato and have been previously described (Afonso et al. ...
-
No products found
because this supplier's products are not listed.
Igal Sterin, et al.,
bioRxiv - Neuroscience 2024
Quote:
eGFP: EGFP (pAcGFP1-N1, Clontech)
-
No products found
because this supplier's products are not listed.
Nora Assendorp, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Brain floating slices were incubated 3 days at 4°C in the blocking condition with primary antibody chicken anti-EGFP (1:1,000; ab13970, Abcam). After three PBS washes ...
-
No products found
because this supplier's products are not listed.
Johanna M. Johansson, et al.,
bioRxiv - Bioengineering 2024
Quote:
... eGFP reverse: 5′-AAG TCG TGC TGC TTC ATG TG -3′ (Sigma); GAPDH forward ...
-
No products found
because this supplier's products are not listed.
Bianca Dietrich, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... fused at its C-terminus to eGFP (synthesized by GenScript), was cloned into piggyBac-Tre-Dest-rtTA-HSV-neo plasmid ...
-
No products found
because this supplier's products are not listed.
Thomas S van Zanten, et al.,
bioRxiv - Biophysics 2022
Quote:
... EGFP-EGFP-EGFP-N1 or VsV-G-EGFP 12-16 hours before the experiment using Fugene6 (Promega). CHO cells stably expressing GFP-GPI were obtained earlier (Sharma et al. ...
-
No products found
because this supplier's products are not listed.
Peter S J Bailey, et al.,
bioRxiv - Cell Biology 2020
Quote:
... S141A ABHD11 and H296A ABHD11 with C-terminal eGFP tags or HA tags were created using NEBuilder HiFi (NEB). ABHD11 was also cloned into a transfection vector ...
-
No products found
because this supplier's products are not listed.
Gabrielle Moody, et al.,
bioRxiv - Neuroscience 2022
Quote:
... were transfected into HEK293 cells at a ratio of 3:3:1 (hGluN1/hGluN2A/EGFP) using X-tremegene HP (Roche) at a 1:100 ratio with optiMEM ...
-
No products found
because this supplier's products are not listed.
Saltanat Ualiyeva, et al.,
bioRxiv - Immunology 2023
Quote:
... ChATBAC-eGFP [B6.Cg-Tg(RP23–268 L19-EGFP)2Mik/J] (ChAT-eGFP) from Jackson Laboratories and Pou2f3‒/‒ described previously (27 ...
-
No products found
because this supplier's products are not listed.
X. Rosa Ma, et al.,
bioRxiv - Neuroscience 2021
Quote:
... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
No products found
because this supplier's products are not listed.
Kevin Schmidt, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Fibroblast Basal Medium 3 (C-23230, PromoCell, Heidelberg, Germany) containing 10% (v/v ...
-
No products found
because this supplier's products are not listed.
Jordan A. Stinson, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Stable integration was confirmed after sorting EGFP+ cells 3-4 days after transfection (BD FACS Aria). Protein was produced from IL-2 and IL-12 expressing stable lines during one-week culture in serum-free media (Freestyle 293 ...
-
No products found
because this supplier's products are not listed.
Camila Marques-da-Silva, et al.,
bioRxiv - Immunology 2024
Quote:
... anti-mouse NOX4 (Clone C-3, Santa Cruz), anti-mouse GBP1 (Clone G-12 ...
-
No products found
because this supplier's products are not listed.
Cédric Dresch, et al.,
bioRxiv - Plant Biology 2023
Quote:
... 4°C (Merck 3-16KL, KGaA®, Germany). Supernatant was collected and filtered through PTFE membrane filter (0.2 μm ...
-
No products found
because this supplier's products are not listed.
Naama Pnina Dekel-Bird, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... cleaved caspase-3 (cat#C-9664) (Cell Signaling), or Mcl-1 (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Sabrina Traxel, et al.,
bioRxiv - Immunology 2024
Quote:
... Fluorescent (EGFP) images were captured using the Cytation 3 (BioTek) with a 4x objective ...
-
No products found
because this supplier's products are not listed.
Ricardo Coelho, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Caspase 3 and 8 activity (EGFP+ cells) was analyzed using the CytoFLEX Flow Cytometer (Beckman Coulter) and Flowjo v10 BD (Becton Dickinson ...
-
No products found
because this supplier's products are not listed.
Michael Thomson, et al.,
bioRxiv - Microbiology 2020
Quote:
... for 3 hours at 37°C and purified using RNAeasy columns (Qiagen) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Bárbara Adem, et al.,
bioRxiv - Cell Biology 2021
Quote:
... anti-eGFP (BIO-RAD 81/4745-1051), anti-mCherry ...
-
No products found
because this supplier's products are not listed.
Gabriela O. Bodea, et al.,
bioRxiv - Genomics 2023
Quote:
... Transgenic L1-EGFP brains were sectioned on a cryostat (Leica, settings OT=-20°C, CT=-20°C) at 40µm thickness ...
-
No products found
because this supplier's products are not listed.
Wenchao Li, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... EGFP (Proteintech, cat ...
-
No products found
because this supplier's products are not listed.
Byungjin Lee, et al.,
bioRxiv - Bioengineering 2024
Quote:
Plasmids encoding expression of C-terminally eGFP-tagged PafA variants were produced via Gibson assembly and QuickChange mutagenesis (Agilent) as previously described62 ...
-
No products found
because this supplier's products are not listed.
Aleksandra E. Sikora, et al.,
bioRxiv - Microbiology 2020
Quote:
Female BALB/c mice (3-4 weeks old, Charles River Laboratories, NCI BALB/c strain) were immunized by subcutaneous injection of 20 μg of rMetQ mixed with 80 μL of Titermax Gold (Invivogen ...
-
No products found
because this supplier's products are not listed.
Elena A. Westeinde, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and an eGFP long-pass filter cube (Olympus F-EGFP LP). The fly was illuminated from below using a fiber optic coupled LED (M740F2 ...
-
No products found
because this supplier's products are not listed.
N. Kakava-Georgiadou, et al.,
bioRxiv - Neuroscience 2022
Quote:
... with chamber temperature of 21 ± 3°C and object temperature of 19±3°C and sections were mounted directly on Superfrost glass (631-0108, VWR, Leuven, The Netherlands) in series of 10 per each brain and stored at −80°C.
-
No products found
because this supplier's products are not listed.
Johnny A. Z. Rockenbach, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Live imaging of cells expressing RCP-EGFP (Supplementary Movie 3) were processed with “Denoise.AI” from Nikon NIS-Elements ...
-
No products found
because this supplier's products are not listed.
Zaza Gelashvili, et al.,
bioRxiv - Cell Biology 2024
Quote:
... single intact and anesthetized 3 dpf Tg (mpeg1.1:Qf2;Quas:cPla2-mKate2-P2A-eGFP-KDEL) were embedded in 60mm plastic petri dish (Corning, 351007) and immobilized with ∼200μL 1% LM agarose ISO(NaCl ...
-
No products found
because this supplier's products are not listed.
Saori Shinoda, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) (850375 C; Avanti Polar Lipids), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE ...
-
No products found
because this supplier's products are not listed.
Bianca S. Bono, et al.,
bioRxiv - Neuroscience 2024
Quote:
... the tissues were first treated with HRP-C2 (15 min, 40 °C; 323105, ACD) to develop Egfp hybridization visualized with Opal 520 (FP1487001KT, PerkinElmer, Waltham, MA) diluted in TSA buffer (1:750 ...
-
No products found
because this supplier's products are not listed.
Marie-France Dorion, et al.,
bioRxiv - Neuroscience 2023
Quote:
... anti-CX-3-C motif chemokine receptor 1 (CX3CR1; clone #2A9-1, Biolegend), anti-Mer tyrosine kinase (MERTK ...
-
No products found
because this supplier's products are not listed.
Sanduni I. Fernando, et al.,
bioRxiv - Biophysics 2023
Quote:
U2OS cells grown in #1.5H Ibidi chambers (µ-Slide 8 well Cat#80826) at 37°C in 5% CO2 airgas were fixed in 37°C 3% paraformaldehyde (EMS) and 0.1% glutaraldehyde (EMS ...
-
No products found
because this supplier's products are not listed.
Parishmita Sarma, et al.,
bioRxiv - Biochemistry 2022
Quote:
... cells were further incubated at 37°C for 10 min in the Flex Station 3 (Molecular Devices) before the assay was initiated ...
-
No products found
because this supplier's products are not listed.
Sara Dochnal, et al.,
bioRxiv - Microbiology 2022
Quote:
... and heat shock (3 hours at 43 □C) in BrainPhys (Stem Cell Technologies) supplemented with 2 mM L-Glutamine ...
-
No products found
because this supplier's products are not listed.
Inseon Kim, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and 3 µM CHIR99021 (C) (R&D Systems, 4423/50).
-
No products found
because this supplier's products are not listed.
Arwin Groenewoud, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 20 ng/mL EGFP (Peprotech), 5 U/mL heparin and 1x primocin (Invivogen) ...
-
No products found
because this supplier's products are not listed.
Pascal A. Pieters, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... The reactions were incubated at 29 °C and eGFP and optionally eCFP fluorescence was measured on a Saffire II (Tecan), Spark 10M (Tecan ...
-
No products found
because this supplier's products are not listed.
Claire L Burgess, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Media was then changed to cSFDM with 3 uM CHIR99021 (“C”; Tocris), recombinant human BMP4 (10 ng/ml ...
-
Chromatographically purified. A dialyzed, lyophilized pre-activated powder.
Cat# LS001643,
5x1 mg, $166.00
Ask
Frank A. Buquicchio, et al.,
bioRxiv - Immunology 2022
Quote:
... Chopped samples were incubated at 37°C for 30 min in collagenase III (3 mg/ml; Worthington). Liver samples were excised and meshed into single-cell suspensions through 70 μm meshes ...
-
No products found
because this supplier's products are not listed.
Taichi Sugawara, et al.,
bioRxiv - Cell Biology 2020
Quote:
... were incubated with GST or GST-tagged angulin-1 cytoplasmic region (409-575 aa or 409-570 aa) for 2-3 h at 4°C and further incubated with Glutathione Sepharose 4B beads (GE Healthcare) for 1 h at 4°C ...
-
No products found
because this supplier's products are not listed.
Kevin Castillo, et al.,
bioRxiv - Bioengineering 2023
Quote:
eGFp mRNA (StemMACS eGFP, Miltenyi Biotec) was loaded onto dMWCNTs in a 1:500 mRNA:dMWCNT mass ratio ...
-
No products found
because this supplier's products are not listed.
Jean C. Serrano, et al.,
bioRxiv - Bioengineering 2022
Quote:
... was dissolved for at least 3 hrs at 37 °C in Dulbecco’s Phosphate-Buffered Saline (DPBS, Lonza) at twice the final concentration ...
-
No products found
because this supplier's products are not listed.
Carmen Bekeova, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 3 μm C-18 column (Phenomenex) kept at 35°C ...
-
No products found
because this supplier's products are not listed.
Michael Jakob Pichler, et al.,
bioRxiv - Microbiology 2020
Quote:
... and sonication bath (3×10 sec at 4°C) (Bioruptor, Diagenode). Lysates were centrifuged (14.000x g ...
-
No products found
because this supplier's products are not listed.
Anja M. Touma, et al.,
bioRxiv - Biophysics 2022
Quote:
... construct with a C-terminal eGFP tag and N-terminal FLAG tag was generated and subcloned into a shuttle vector provided by Vector Laboratories, Burlingame ...
-
No products found
because this supplier's products are not listed.
J. Christopher Rounds, et al.,
bioRxiv - Neuroscience 2021
Quote:
... brains were left rocking at 4°C for 1-3 nights in 0.1% PBS-T supplemented with blocking agent normal goat serum (Jackson ImmunoResearch) at a 1:20 dilution ...
-
No products found
because this supplier's products are not listed.
Marta Popęda, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Prostate cancer cell line PC-3 cells that expressed EMD-EGFP were left to attach on collagen-coated 35 mm glass-bottom dishes (MatTek Life Sciences) for 48h ...
-
No products found
because this supplier's products are not listed.
Xier Luo, et al.,
bioRxiv - Genomics 2021
Quote:
... and (3) 134 Gb (~100× depth) chromosome conformation capture sequencing (Hi-C) data (sequenced by Illumina platform).
-
No products found
because this supplier's products are not listed.
Anika J. Friedman, et al.,
bioRxiv - Biochemistry 2022
Quote:
... and 2-[(Carboxy-carbonyl)amino]-4,5,6,7-tetrahydrothieno[2,3-c]pyridine-3-carboxylic acid hydrochloride (TCS 401) from Cayman Chemical (Ann Arbor, Michigan) and Ertiprotafib from Med-Koo Biosciences ...
-
No products found
because this supplier's products are not listed.
Mart G. F. Last, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... 3 μL of sample (10 μM EGFP in PBS) was deposited onto glow-discharged grids (Electron Microscopy Science and Quantifoil – see Table 1), prior to blotting the grids from the sample-side for 3 seconds.