Labshake search
Citations for Addgene :
1 - 50 of 2520 citations for pIEXBac c EGFP 3 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... 3 μg of pIRES-eGFP plasmid DNA (Addgene) were digested with 250 U of Benzonase ...
-
bioRxiv - Cell Biology 2023Quote: The α5 with C-terminal EGFP tag (α5-EGFP) was a gift from Rick Horwitz (Addgene plasmid #15238 ...
-
bioRxiv - Cell Biology 2023Quote: ... The α9 with C-terminal EGFP tag (α9-EGFP) was a gift from Dean Sheppard (Addgene plasmid #13600 ...
-
bioRxiv - Cell Biology 2020Quote: ... 5′-CAAACAATCAGCAATGCCTG-3′ and 5′-TGAAGTATTCAGAACAGAAG-3′ and cloned into pX330-P2A-EGFP (Addgene) through ligation using T4 ligase (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and C-FLAG-D20 or EGFP (pEGFP-N1-FLAG, Addgene 60360) chimeras were also subcloned into the XhoI and MfeI linearized attb-BSDr vector using the NEBuilder HiFi Assembly Kit ...
-
bioRxiv - Immunology 2023Quote: Human CD86 C-terminally tagged with enhanced GFP (pCD86-EGFP, Addgene) was sub-cloned into a modified version of the MSCV2.2 retroviral plasmid in which the IRES-GFP cassette was removed ...
-
bioRxiv - Neuroscience 2021Quote: pAAV-CaMKIIa-eGFP (titer ≥ 3×1012 vg/mL, Addgene, catalog # 50469-AAV5) and pAAV5-CaMKII-hChR2(H134R)-eYFP-WPRE (titer ≥ 1×1013 vg/mL ...
-
bioRxiv - Cell Biology 2023Quote: ... 3) pMXs-IP-EGFP-mATG5 was a gift from Noboru Mizushima (Addgene plasmid #38196 ...
-
bioRxiv - Genetics 2022Quote: ... 500 ng/ul pBac[3xP3-EGFP;Tc’hsp5’-Gal4Delta-3’UTR] (Addgene #86449), 80 ng/ul Of-v gRNA described above (see “CRISPR/Cas9 mutagenesis of Of-vermilion”) ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV8-hSyn-EGFP (1μL per site, titer ≥ 3 ×1012 vg/mL, Addgene) was injected bilaterally in the dHP ...
-
bioRxiv - Neuroscience 2022Quote: miR-30a-chimeric hairpins for miR-329 and miR-495 stable overexpression were generated via polynucleotide cloning into the 3’ UTR of eGFP in pAAV-hSyn-EGFP vector (Addgene Plasmid #114213) using BsrGI and HindIII sites ...
-
bioRxiv - Biochemistry 2024Quote: ... The 3×HA and 3×HA-GFP sequences were cloned from pMXs-3XHA-EGFP-OMP25 plasmid (Addgene 83356).
-
bioRxiv - Biochemistry 2021Quote: ... or control peptides with the binding motifs mutated were fused to C terminus of EGFP and cloned to pLJM1-EGFP vector (David Sabatini lab, Addgene plasmid #19319).
-
bioRxiv - Evolutionary Biology 2020Quote: ... EGFP was amplified from pN1-EGFP (Addgene) using primers EGFP_F (5’-GGAGGACTCGAGATGGTGAGCAAGGGCGA ...
-
bioRxiv - Cancer Biology 2022Quote: ... or EGFP (pQCXIP-EGFP-F, Addgene #73014). MIA PaCa-2 WT-RFP were mixed 1:1 with TSC1/TSC2 KO-GFP cells ...
-
bioRxiv - Genomics 2022Quote: ... gRNAs were constructed from pSLQ2853-3 pHR: U6-Sasgv2CXCR4-1 CMV-EGFP (Addgene 84254) and pSLQ1852-2 pHR ...
-
bioRxiv - Synthetic Biology 2022Quote: ... C-terminal His-tagged eGFP plasmid was from our lab stock (Addgene, No. 178422)32 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pAc5.1B-EGFP-DmDCP1 or pAc5.1B-EGFP-DmGW182 (Addgene plasmids #21682 ...
-
bioRxiv - Cell Biology 2023Quote: ... and EGFP of pSIL-eGFP (Addgene plasmid #52675) to form a pShuttle-U6-MCS-CMV-GFP vector ...
-
bioRxiv - Neuroscience 2023Quote: Unilateral stereotaxic injections of AAV5-CaMKIIα-EGFP (Addgene #50469; virus titer ≥ 3×10¹² vg/mL) and AAV5-hSyn-DIO-hM4D(Gi)-mCherry (Addgene #44362 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and EGFP from PL-SIN-PGK-EGFP (Addgene #21316) with Gibson Assembly primers ...
-
bioRxiv - Neuroscience 2024Quote: ... floxed EGFP (AAV8; pAAV-hSyn-DIO-EGFP; Addgene #50457) were bilaterally injected to the BLA of adult (>P55 ...
-
bioRxiv - Cell Biology 2022Quote: ... and AAV8-CMV-eGFP (pAAV.CMV.PI.EGFP.WPRE.bGH, Addgene #105530-AAV8 eGFP) viruses with the amount of 100 ...
-
bioRxiv - Biochemistry 2023Quote: pCAG-EGFP or pCX-HO1-2A-EGFP (Addgene, #74672) were transfected using a standard Lipofectamine 2000 protocol ...
-
bioRxiv - Bioengineering 2024Quote: ... and pHIV-eGFP encoding eGFP (21373 purchased from Addgene) using polyethylenimine (PEIMax ...
-
bioRxiv - Developmental Biology 2021Quote: ... The fragment has been amplified using the primers F-5’-TGCAGGATCCCATCGATTCGGCCACCATGAAACGGACAG -3’ and R-5’-TAGAGGCTCGAGAGGCCTTGTCAGACTTTCCTCTTCTTCTTGG -3’) from the pCAG-CBE4max-SpG-P2A-EGFP plasmid (Addgene plasmid #139998)14 and from the pCAG-CBE4max-SpRY-P2A-EGFP plasmid (Addgene plasmid #139999)14.
-
bioRxiv - Molecular Biology 2021Quote: Drosophila reporter plasmids expressing eGFP (Hy_pMT eGFP SV40; Addgene #69911), Laccase2 Exons 1-3 (Hy_pMT Laccase2 Exons 1-3 ...
-
bioRxiv - Neuroscience 2020Quote: ... The eGFP sequence of AAV-CMV-eGFP (Addgene plasmid # 67634) was amplified by using the primers 5’ GGAATTCATGGTGAGCAAGGGCGAG 3’ and 5’ AGCGCTTTACTTGTACAGCTCGTCCATG 3’ ...
-
bioRxiv - Neuroscience 2021Quote: ... eGFP was amplified from plasmid pLV-eGFP (Addgene cat. #36083) and the flanking NheI and KpnI restriction sites were introduced ...
-
bioRxiv - Cell Biology 2020Quote: ... SU9-eGFP and pBI-eGFP plasmids were purchased from Addgene. Human ABCB7 cDNA plasmid was a generous gift from Dr ...
-
bioRxiv - Neuroscience 2023Quote: ... viral prep #50477-AAV8) or eGFP (AAV8-CaMKIIa-EGFP, Addgene, Cambridge ...
-
bioRxiv - Cancer Biology 2024Quote: ... containing a C-terminus EGFP-tagged sequence of the full-length M237I p53 protein (Addgene, #11770), and 4 µL of Lipofectamine 2000 reagent ...
-
bioRxiv - Immunology 2024Quote: ... and P2A-EGFP at the C terminus was subcloned into the pMy retroviral backbone (Addgene # 163361) using Gibson assembly ...
-
bioRxiv - Cell Biology 2022Quote: ... EGFP (Addgene #89684), and dCas13b-hADDR2 (Addgene #103871 ...
-
bioRxiv - Cell Biology 2021Quote: ... eGFP (Addgene #34680); dynamin-2_K44A-eGFP ...
-
bioRxiv - Cell Biology 2021Quote: ... Seipin-EGFP (Addgene plasmid #129719 ...
-
bioRxiv - Neuroscience 2021Quote: ... pTRE-EGFP (Addgene plasmid #89871 ...
-
bioRxiv - Biophysics 2023Quote: EGFP-Rab5 (Addgene) was a gift from Arnab Gupta ...
-
bioRxiv - Cell Biology 2024Quote: ... eGFP-BICD1 (Addgene #49487 ...
-
bioRxiv - Neuroscience 2024Quote: ... eGFP-Cre.WPRE.SV40 (Addgene, #105540-AAV8 ...
-
bioRxiv - Immunology 2023Quote: ... eGFP (Addgene #22152) was included at a 1:10 dilution (0.25 µg ...
-
bioRxiv - Molecular Biology 2021Quote: ... Drosophila reporter plasmids expressing eGFP (Hy_pUbi-p63e eGFP SV40; Addgene #132650) under the control of the Ubi-p63e promoter was described previously (40) ...
-
bioRxiv - Neuroscience 2020Quote: ... EGFP sequence was obtained from pcDNA3-EGFP plasmid (Addgene plasmid 13031). DNA constructs were eventually subcloned into AAV9 transfer plasmids for viral production [49] ...
-
bioRxiv - Physiology 2021Quote: EGFP-hArgonaute-2 (eGFP-Ago2) was purchased from (Addgene plasmid # 21981) and was prepared in the laboratory of Philip Sharp (MIT) ...
-
bioRxiv - Genetics 2022Quote: EGFP sequences were amplified by PCR from pGEM5Z(+)-EGFP (Addgene #65206) and were cloned into p(UASp ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... pCMV-p38-CA-EGFP and pCMV-eGFP-N1 (Addgene, 6085-1) by using standard Lipofectamine 3000 protocols (ThermoFisher ...
-
bioRxiv - Neuroscience 2023Quote: ... eGFP (AAV8-CaMKIIa-EGFP, packaged by Addgene, viral prep #50469-AAV8) was infused into ACC ...
-
bioRxiv - Molecular Biology 2024Quote: ... farnesylated HRAS-EGFP (26) fusion protein (CAAX-EGFP, Addgene plasmid # 86056) provided dynamic visualization of the Golgi and plasma membrane during imaging ...
-
bioRxiv - Microbiology 2024Quote: The full-length HIV vectors NL4-3 ΔEnv EGFP (HIV Reagent Program) and HIVGKO (Addgene plasmid #112234) were produced in HEK293T cells along with the VSV-G (Addgene plasmid # 8454 ...
-
bioRxiv - Neuroscience 2023Quote: ... or a control virus (AAV2-hSyn-DIO-EGFP, 100 µL at titer ≥ 3×10¹² vg/mL, Addgene). A subset of the optogenetic L6-CT experiments was done in Ntsr1-Cre-ChR2-EYFP mice ...