Labshake search
Citations for Qiagen :
1 - 50 of 1199 citations for pIEXBac c EGFP 3 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... for 3 hours at 37°C and purified using RNAeasy columns (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... using a TissueLyser (2 × 30 Hz, 3 min at 4°C; QIAGEN). After homogenization ...
-
bioRxiv - Neuroscience 2024Quote: ... using a TissueLyser (2 × 30 Hz, 3 min at 4°C; QIAGEN). After homogenization ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
Dimeric prion protein ligand activates Adgrg6 but does not rescue myelinopathy of PrP-deficient micebioRxiv - Neuroscience 2020Quote: ... The temperature was increased from 25 °C to 95 °C at 3 °C per minute and fluorescence was measured at 610 nm in a Rotor-Gene Q thermocycler (Qiagen). The experiment was performed in technical triplicates ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genomic DNAs were purified from 3 mL overnight cultures grew at optimum temperature (30 °C or 37 °C) by Dneasy Blood & Tissue Kits (QIAGEN). Additionally ...
-
bioRxiv - Molecular Biology 2023Quote: ... EGFP-ZMYM2(WT) (pAS4329) or EGFP-ZMYM2(SIMmut) (pAS4330) plasmids using Polyfect Transfection Reagent (Qiagen, Cat. No. ID: 301105) for 24 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... epithelial cells (DAPI-EGFP+CD45-) and fibroblasts (DAPI-EGFP-CD45-CD11b-CD31-CD3-) were sorted and lysed in RLT buffer (Qiagen). Total RNA was prepared using RNeasy (Qiagen ...
-
bioRxiv - Bioengineering 2024Quote: The EGFP-positive and EGFP-negative subpopulations of MDA-MB-231 cells were lysed using RNeasy Plus Mini Kit (74134; QIAGEN) and kept at −80°C until needed ...
-
bioRxiv - Cell Biology 2023Quote: ... using Effectene (Qiagen U2-OS KI eGFP-DEK) or Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... CMV-EGFP transgenic (positive control) and 0.3k hGPR56 e1m–EGFP transgenic marmosets using AllPrep DNA/RNA Micro Kit (QIAGEN, Hilden, Germany). For sperm genomic PCR ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were incubated for 3 minutes at 56°C in a deparaffinization solution (Qiagen, 19093). A step of digestion with Proteinase K was performed followed by a treatment with DNAses ...
-
bioRxiv - Genetics 2022Quote: ... 3 min in 37°C shaker) and processed with DNeasy Blood and Tissue Kit (QIAGEN #69504). Two hundred ng of genomic DNA was used as input in the DamID protocol that included an improved pool of AdR primers as described (de la Cruz Ruiz et al ...
-
bioRxiv - Bioengineering 2024Quote: ... we isolated genomic DNA from individual mosquitoes in both EGFP-positive and EGFP-negative groups using the Blood & Cell Culture DNA Midi Kit (Qiagen, Cat. No./ID: 13343). Primers specific to Y chromosome-linked genes were employed in PCR to determine male mosquitoes among both EGFP-positive and EGFP-negative larvae [44].
-
bioRxiv - Developmental Biology 2021Quote: ... EGFP+ cells were directly FAC-sorted into RLT lysis buffer (Qiagen). After collection ...
-
bioRxiv - Cell Biology 2021Quote: ... or EGFP-Lin52 fusions into HEK293-GP cells with Effectene (Qiagen) for transduction as described previously (58).
-
bioRxiv - Cell Biology 2020Quote: ... pBI-UASc-APP695-EGFP was co-transfected using Effectene reagent (Qiagen) with pACSwitch (gift from M ...
-
bioRxiv - Bioengineering 2024Quote: ... pET/EGFP-strep-his was miniprepped according to manufacturer’s instructions (Qiagen) and transformed into competent Escherichia coli BLR (DE3 ...
-
bioRxiv - Biochemistry 2023Quote: ... for 45 min at 4°C and the supernatant was mixed with 3 mL Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... for 45 min at 4°C and the supernatant was mixed with 3 mL Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Genomics 2021Quote: ... EGFP positive ECs were collected in RLT buffer (RNeasy Micro kit, Qiagen).
-
bioRxiv - Cell Biology 2023Quote: ... or BubR1-EGFP each under low/endogenous-expression promoters using Effectene (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2022Quote: ... Ten millilitres of culture were pelleted by immediate centrifugation (5,000 × g for 3 min at 4°C) and resuspended in 5 mL of RNAlater (76106; Qiagen). Samples were stored at 4°C overnight ...
-
bioRxiv - Bioengineering 2024Quote: Ten millilitres of culture were pelleted by centrifugation (5,000 × g for 3 min at 4°C) and resuspended in 5 mL of RNAlater (76106; Qiagen). Samples were stored at 4°C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... #3: 5’-AAGCATCGATAGGTAAGTTGA-3’ (SI03130008, Qiagen); #4 ...
-
bioRxiv - Biochemistry 2024Quote: ... The remaining supernatant was centrifuged again at 5,000 x g for 20 minutes at 4°C and equilibrated for 1 hour in 3 mL of Ni-NTA resin (Qiagen) that was pre-equilibrated in the extraction buffer ...
-
bioRxiv - Immunology 2022Quote: ... Kidneys were mechanically disrupted with metal beads during 3 min at 4°C and DNA was then extracted using QIAmp DNA kit (Qiagen). Leptospiral DNA was specifically targeted using primers and probes designed in the lpxA gene (L ...
-
bioRxiv - Biophysics 2022Quote: ... The liquid culture was then grown for 3 hours at 37°C before the plasmid extraction using a miniprep kit (QIAGEN). Prepared DNA was sequenced by the Microbial Genome Sequencing Center (https://www.seqcenter.com/ ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... CCR6int and CCR6high subsets of CD4+ T cells were used for isolating RNA without and with prior activation with 20 ng/ml PMA and 1 mM ionomycin for 3 h at 37°C under 5% CO2 using RNeasy Mini Kit (Qiagen) and gene expression levels were determined using Illumina Human WG6 Expression BeadChip Version 3 arrays (Illumina Inc. ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’; Qiagen), si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’, Qiagen), si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’ ...
-
bioRxiv - Genomics 2022Quote: ... Cells were maintained at 37°C in 5% CO2 for 3 days before collecting genomic DNA using DNeasy Blood & Tissue Kits (Qiagen, 69504) and sequencing.
-
bioRxiv - Cell Biology 2021Quote: ... E2D2/3 (5’-AACAGUAAUGGCAGCAUUUGU-3’) and E2D4 siRNAs (5’ – CCGAAUGACAGUCCUUACCAA-3’) all from Qiagen, USA(83).
-
bioRxiv - Plant Biology 2022Quote: ... Tissue was ground to a fine powder at −80°C using 3-mm stainless steel beads at 50 Hz for 2*30 seconds in a TissueLyser LT (Qiagen, Germantown, USA). Ground samples were extracted with 1 mL of cold methanol containing [phenyl 13C6]-IAA (0.1 nmol/mL ...
-
bioRxiv - Plant Biology 2023Quote: ... Collected tissue was ground to a fine powder at -80°C using 3 mm stainless steel beads at 50 Hz for 2*30 seconds in a TissueLyser LT (Qiagen, Germantown, USA), and between 10-15 mg of ground tissue per sample was used for auxin extraction ...
-
bioRxiv - Plant Biology 2022Quote: ... Tissue was ground to a fine powder at −80°C using 3-mm stainless steel beads at 50 Hz for 2*30 seconds in a TissueLyser LT (Qiagen, Germantown, USA). Ground samples were extracted with 1 mL of cold methanol containing [phenyl 13C6]-IAA (0.1 nmol/mL ...
-
bioRxiv - Cancer Biology 2023Quote: ... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... TATA/TATA and lmo1-/- in the MYCN;EGFP background using the QIAzol lysis reagent (Qiagen) and was cleaned using the RNeasy kit (Qiagen) ...
-
bioRxiv - Neuroscience 2024Quote: Total RNAs were extracted from the FACS-isolated EGFP+ OLs with RNeasy Micro kit (Qiagen). For total RNA extraction from the other hemisphere forebrain (without OL sorting) ...
-
bioRxiv - Microbiology 2021Quote: ... The reference sample and each group of EGFP+ cells were subjected to genomic extraction (QIAGEN, 69506), PCR amplification of the sgRNAeBAR sequences (KAPA ...
-
bioRxiv - Biochemistry 2020Quote: ... Released affinity tags containing Flag-EGFP were removed from the mixture by a Ni-NTA resin (QIAGEN). The non-absorbed fractions were concentrated and subjected to a size-exclusion column chromatograph using a Superose6 Increase column (GE Healthcare) ...
-
bioRxiv - Cell Biology 2024Quote: ... PV-eGFP plasmid was linearized with ApaI and purified with QIAEX II Gel Extraction Kit (Qiagen, Netherlands). Viral RNA was then transcribed at 37°C for 5.5 hours in a 20-μL reaction medium containing 350 mM HEPES pH 7.5 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-TGGTTCTACATCAGAGTTGTT-3’ (Qiagen). Lentiviral particles expressing SMART vectors doxycyclin-inducible shRNA were from Dharmacon as follows ...
-
bioRxiv - Developmental Biology 2021Quote: ... all remaining bead-bound EGFP+ nuclei were processed for RNA extraction using the RNeasy Plus Micro kit (Qiagen). Nuclear RNA-seq libraries were constructed with the Stranded RNA-seq Kit with Ribo Erase (Kapa Biosystems ...
-
bioRxiv - Molecular Biology 2020Quote: ... The eGFP-AID-Usp9x vector was also digested with BamHI/XhoI and cleaned up by gel extraction (Qiagen). The 3xFlag sequence was then ligated into the digested eGFP-Usp9x plasmid (Takara DNA ligation kit #6023).
-
bioRxiv - Developmental Biology 2024Quote: ... using a touchdown PCR for the first 10 cycles from 72 to 60 followed by 35-40 cycles at the proper annealing temperature (Tm −2°C) and extension 68°C 30sec/Kb or 72°C 15sec/Kb and purified using a PCR purification KIT (Qiagen). Equimolar amounts of PCR products were mixed and a PCR was made with a primeSTAR GXL DNA polymerase (Takara Bio ...
-
bioRxiv - Physiology 2020Quote: ... Erythrocytes were lysed for 3 minutes with 3 ml of EL buffer (Qiagen). After Fc blocking for 20 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3’mRNA-seq libraries were prepared using QIAseq UPX 3’ Transcriptome Kit (QIAGEN). In brief ...
-
bioRxiv - Plant Biology 2022Quote: ... 5’ and 3’ untranslated regions and open reading frames) for the paralogs were made using the CLC Main workbench 7 (QIAGEN® Aarhus A/S, Aarhus C, Denmark). Sequence alignments were generated for the genomic DNA ...
-
bioRxiv - Genetics 2021Quote: ... and end-point PCRs were performed following 34 cycles (94 C 30 sec, 58 C 30 sec, 72 C 1 min) using the HotStarTaq Plus DNA polymerase (Qiagen, Canada) according to manufacturer’s protocol.