Labshake search
Citations for Roche :
1 - 50 of 1185 citations for pIEXBac c EGFP 3 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... were transfected into HEK293 cells at a ratio of 3:3:1 (hGluN1/hGluN2A/EGFP) using X-tremegene HP (Roche) at a 1:100 ratio with optiMEM ...
-
bioRxiv - Cancer Biology 2022Quote: EGFP (Roche; 11814460001 ...
-
bioRxiv - Cell Biology 2020Quote: ... and EGFP (Roche; 11814460001 ...
-
bioRxiv - Biochemistry 2023Quote: ... eGFP (Roche #11814460001), Ubiquitin (Proteintech #12986-1-AP ...
-
bioRxiv - Cell Biology 2021Quote: We immunoprecipitated EGFP-labeled imaginal disc nuclei with mouse anti-EGFP (Roche, cat. #11814460001). For immunofluorescence ...
-
bioRxiv - Cell Biology 2021Quote: ... Commercial primary antibodies: EGFP (Roche), Myc (9E10 ...
-
bioRxiv - Pathology 2020Quote: C-reactive protein was measured using the Tina-quant C-Reactive Protein Gen.3 reagent (Roche, Basel, Switzerland) designed to achieve very high sensitivity ...
-
bioRxiv - Molecular Biology 2024Quote: ... eGFP (mouse 1:2000, 11814460001, Roche) and Pgk1-HRP (mouse ...
-
bioRxiv - Cell Biology 2024Quote: ... Mouse monoclonal anti-EGFP (Roche, 11814460001), WB (1:2000) ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse monoclonal antibodies targeting GFP/EGFP (Roche), ubiquitin P4G7 (Biolegend) ...
-
bioRxiv - Plant Biology 2020Quote: ... A monoclonal antibody for eGFP (Roche, Basel, Switzerland) was used for Western blotting analysis at 1:10000 dilution ...
-
bioRxiv - Microbiology 2022Quote: ... 45 cycles of 95°C for 3 s and 60°C for 30 s using the LightCycler 96 system (Roche, Basel, Switzerland) or the StepOnePlus™ Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Microbiology 2022Quote: ... initial denaturation at 95°C for 3 min, followed by 40 cycles of amplification (95°C for 15 sec, 60°C for 30 sec) (Roche LightCycler 96, Roche Diagnostics). For absolute quantification ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-EGFP clones 7.1 and 13.1 (mouse monoclonal, Roche 11814460001), anti-Endophilin A2 clone H-60 (rabbit polyclonal ...
-
bioRxiv - Microbiology 2022Quote: ... at 37 °C for 3 hours followed by 19 μg/sample of trypsin (Roche Cat. Nr. 11418025001) at 37 °C for 13 hours ...
-
bioRxiv - Bioengineering 2024Quote: ... mouse anti-EGFP (Cat no. 11814460001, Roche Diagnostics, 1:5000 dilution), and mouse anti-Actin (Cat no ...
-
bioRxiv - Biochemistry 2023Quote: ... Reactions were incubated at 37°C for 3-4 h before adding DNase I (0.1 U/µl) (Roche) and incubating for another 30 min at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... pMSCVpuro or pMSCVpuro-mRFP-EGFP-rLC3 using FuGENE® 6 (Roche, #11988387001). For the retroviral infection ...
-
bioRxiv - Cell Biology 2021Quote: ... 12-20 ml of pre-warmed to 37 °C enzyme buffer solution (EBS) with 2.3 U of Liberase Blendzyme 3 recombinant collagenase (Roche) were cannulated into the vena cava to isolate hepatocytes ...
-
bioRxiv - Neuroscience 2022Quote: ... Myelin was washed by dilution in HBSS and centrifuged at 400 x g for 5 min at 4 °C before suspending in 3 mL ice cold 0.32 M sucrose solution containing protease inhibitor cocktail (Roche). Next ...
-
bioRxiv - Bioengineering 2022Quote: ... and then inflated via the trachea with 2-3 mL of pre-warmed (37°C) enzyme solution (1 mg/mL collagenase/dispase [Roche] ...
-
bioRxiv - Neuroscience 2021Quote: ... and PI) and de-glycosylated for 3 h at 37 °C with 1 unit of PNGase-F (Roche Applied Science) added per 10 μl volume ...
-
bioRxiv - Developmental Biology 2020Quote: ... They were then blocked in PBS with 3% BSA for 3h at RT and incubated overnight at 4°C with a peroxidase-labeled anti-DIG antibody (Roche) diluted 1:1500 in PBS with 3% BSA ...
-
bioRxiv - Molecular Biology 2022Quote: ... blots were hybridized with 10 pmol/ml DIG-labeled (CAG)7 (5′-gcAgCagcAgca-3′) at 70°C for 4 h in hybridization buffer (5 × SSC, 1% block solution [Roche, Switzerland] ...
-
bioRxiv - Neuroscience 2024Quote: ... the slides were incubated for ∼72 hours at 37°C in staining solution containing nitro blue tetrazolium and 5- bromo-4-chloro-3-indolyl-phosphate (Roche). The slides were finally washed ...
-
bioRxiv - Biophysics 2024Quote: ... 150 mM NaCl and 2 mM CaCl2 (“Na + Ca”) were incubated at 37° C with Proteinase K (3 μg/ml) (Roche). Aliquots are removed at different time intervals following addition of the protease (0 ...
-
bioRxiv - Neuroscience 2022Quote: The NLS-EGFP cassette was PCR-amplified using KAPA HiFi HotStart ReadyMix (Roche) using the plasmid pAAV2-CAG-ChR2d-2A-NLS-EGFP (kind gift of Botond Roska ...
-
bioRxiv - Immunology 2021Quote: Total protein lysates from MDDC and cDC cultured for 1 h in the presence of media or individual or combined Poly I:C and 2′3′-di AM(PS) agonists were obtained using RIPA buffer containing 1% phosphatase and protease inhibitors (Roche Diagnostics). Subsequently ...
-
bioRxiv - Genomics 2020Quote: ... for 3 mins at 80°C in hybridization solution (10 mM Tris-HCl pH 7.2, 70% formamide, 0.5% Roche 11096176001 blocking reagent). Hybridization was carried out for 2 hours at RT in the dark ...
-
bioRxiv - Cancer Biology 2021Quote: ... and digested either for 1 hour at 37°C in a digestion mix of 3 mg/ml collagenase type A (Roche, 11088793001) and 25 μg/ml DNAse (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... and AdRb (5′-TCCTCGGCCG-3′) were ligated to the DpnI digested fragments in an overnight reaction at 16° C using T4 DNA ligase (Roche, 799009). After incubation the ligase was heat-inactivated at 65° C for 10 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... The gel plugs were incubated at 50°C for 3 days and treated with fresh proteinase K at 20 mg/ml concentration (Roche Diagnostics), every 24 h ...
-
bioRxiv - Cell Biology 2022Quote: ... Binding efficiency was determined by Western Blot analysis using an EGFP-antibody (Roche 11814460001) and the ImageQuant LAS-4000 system (Fuji ...
-
bioRxiv - Molecular Biology 2024Quote: ... was annealed with Coccus-R primer (5′–ACG– TCA–GAA–TCG–CTG–C–3′) and analyzed using FastStart Essential DNA Green Master kit (Roche, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... at a ratio of 4.5:4.5:1 (GluN1/GluN2A/EGFP) using X-treme GENE HP (Roche) (for details on cell culture and transfection see Amin et al. ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by 10 minutes at 37°C in a 3% (w/v) collagenase A solution in PBS (Collagenase A, Roche Diagnostics GmbH, Germany, 10103586001). Cells were recovered by centrifugation for 5 minutes at 300g prior cell counting on Malassez cells after Trypan blue staining ...
-
bioRxiv - Biochemistry 2023Quote: ... Glu-C (Roche), and chymotrypsin (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... Lys-C (Roche), Glu-C (Roche) ...
-
bioRxiv - Biophysics 2024Quote: ... and pLL5.0-eGFP (500 ng each) plasmids into HEK293FT cells using X-tremeGENE HP transfection reagent (Roche). Lentivirus was harvested 72 hours later and subsequently used to infect JR20 MEFs supplemented with 4 μg/mL of Polybrene (Santa Cruz) ...
-
bioRxiv - Biophysics 2021Quote: ... 3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate (CHAPS, Roche Life Sciences, Indianapolis, IN) micelles and also using 1,2-dihexanoyl-sn-glycero-3-phosphocholine (DHPC)/1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC ...
-
bioRxiv - Immunology 2023Quote: ... 3 mM ATP (Roche), 25 μg/ml MSU (InvivoGen) ...
-
bioRxiv - Molecular Biology 2024Quote: Western blots were carried out as described previously (Díaz-López et al., 2019) using the following primary antibodies: anti-EGFP (11814460001, Roche), anti-dsRed (a gift from José María Requena ...
-
bioRxiv - Cancer Biology 2021Quote: ... at 95°C for 5 min (90°C for 15 sec, 60°C for 60 sec) × 50 cycles (Light/Cycler Nano, Roche). The primer sets used in this study were described in the supplemental Table 1.
-
bioRxiv - Microbiology 2022Quote: ... 95°C), annealing (10 sec, 58°C) and elongation (10 sec, 72°C) performed on a LyghtCycler 96 Instrument (Roche). MIC14 and MIC15 transcripts were amplified with the primer pairs P64/P65 and P66/P67 ...
-
bioRxiv - Biophysics 2021Quote: ... Anti-c-Myc (Roche) molecules were covalently linked to the carboxylated polystyrene beads (Spherotech ...
-
bioRxiv - Molecular Biology 2021Quote: ... or Glu-C (Roche) at 25 °C for 30 min ...
-
bioRxiv - Microbiology 2024Quote: ... mitomycin C (Roche Diagnostics) as prophage-inducing reagent [73] was added in triplicates in different final concentrations ...
-
bioRxiv - Cell Biology 2023Quote: ... Mitomycin C (Merck (Roche), 10107409001) ...
-
bioRxiv - Neuroscience 2024Quote: ... Mitomycin C (Roche, 10107409001), soluble cholesterol (Sigma-Aldrich ...