-
No products found
because this supplier's products are not listed.
Jessica C. Orr, et al.,
bioRxiv - Cell Biology 2024
Quote:
... human recombinant interleukin-6 (IL-6; PeproTech) or human recombinant IL-13 (PeproTech ...
-
No products found
because this supplier's products are not listed.
Aleksandr Ianevski, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... One ng/mL recombinant human interleukin (IL)-6 (Gibco, Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Andra C. Dumitru, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 35 pM 35S-GTPγS (Perkin Elmer) and C5a (R&D Systems) ...
-
No products found
because this supplier's products are not listed.
Aida S. Hansen, et al.,
bioRxiv - Immunology 2023
Quote:
... Recombinant human (rh) Interleukin-2 (IL-2, Sigma-Aldrich), rhTNFα (Peprotech ...
-
No products found
because this supplier's products are not listed.
Theofilus A. Tockary, et al.,
bioRxiv - Bioengineering 2022
Quote:
... recombinant human interleukin 4 (IL-4) (R&D Systems), Alpha MEM with nucleosides (StemCell Technologies ...
-
No products found
because this supplier's products are not listed.
Cristina Y. Zamora, et al.,
bioRxiv - Microbiology 2019
Quote:
... 35 ng/mL IL-4 (Biolegend Cat. No. 574004) and 10 nM retinoic acid ...
-
No products found
because this supplier's products are not listed.
Dorothee Kottmeier, et al.,
bioRxiv - Microbiology 2021
Quote:
... HEK293 cells were plated for transfection onto 35 mm poly-L-lysine coated glass-bottom dishes (35-mm) (www.ibidi.com). Transfections of HEK293 were performed with 1.0 µg of expression vector using Lipofectamine 2000 (ThermoFisher) ...
-
No products found
because this supplier's products are not listed.
Jiarui Ding, et al.,
bioRxiv - Genomics 2019
Quote:
... containing 2% human AB serum (Corning, #35-060). We spun down the cells at 300 x g for 10 min at 4 °C and resuspended them in the same medium described above at a concentration of 1 x 108 cells/ml prior to removing dead cells using the EasySep™ Dead Cell Removal (Annexin V ...
-
No products found
because this supplier's products are not listed.
Jonathan M. Goodwin, et al.,
bioRxiv - Cell Biology 2021
Quote:
HEK293 cells were plated on 35 mm glass-bottomed dishes (Mattek, Ashland, MA). Images were acquired every 2 minutes using a spinning disk confocal microscope ...
-
No products found
because this supplier's products are not listed.
Eunchul Kim, et al.,
bioRxiv - Plant Biology 2020
Quote:
... A8-35 (Anatrace) was added at a final concentration of 1% to the solubilized thylakoids for amphipol substitution ...
-
35 mm dish with 14mm micro-well without cover slip.
Cat# D35-14,
100/case, $65.00
Ask
Wei Dong, et al.,
bioRxiv - Cell Biology 2020
Quote:
... HEK293 cells cultured in 35 mm glass bottom dishes (In Vitro Scientific) were transiently transfected with 1 µg total DNA which included the Lyn11-FRB::CFP recruiter ...
-
No products found
because this supplier's products are not listed.
Vidhya M. Ravi, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Interleukin 10 (IL-10, Abcam) at 5 ng/ml ...
-
No products found
because this supplier's products are not listed.
Qi Zhang, et al.,
bioRxiv - Immunology 2021
Quote:
... CD21/35(7G6,BD Biosciences), CD43(eBioR2/60 ...
-
No products found
because this supplier's products are not listed.
M. Faiz, et al.,
bioRxiv - Cell Biology 2024
Quote:
... interleukin (IL) 6 and IL 11 (StemCell Technologies). Cultures were maintained at 37°C in a 5% CO2 humidified atmosphere for 14 days with media changes on days 5 ...
-
No products found
because this supplier's products are not listed.
Giuseppe Sconocchia, et al.,
bioRxiv - Immunology 2021
Quote:
... Human recombinant interleukin-7 (IL-7) and interleukin-15 (IL-15) were purchased from Miltenyi Biotec (Bergisch Gladbach, Germany). Retronectin (Recombinant Human Fibronectin ...
-
No products found
because this supplier's products are not listed.
Brandon Drescher, et al.,
bioRxiv - Neuroscience 2024
Quote:
... at 30-35 nm with 4 mm 35° diamond knives (DiATOME, Hatfield, PA). Reels of collected tape were cut into strips and attached to 100 mm diameter silicon wafers via double-sided conductive tape ...
-
No products found
because this supplier's products are not listed.
Masahiko Nishitani-Isa, et al.,
bioRxiv - Immunology 2021
Quote:
... NG-ABEmax (35) (Addgene plasmid #112095 ...
-
No products found
because this supplier's products are not listed.
Hiroyuki Yamamoto, Tetsuro Matano,
bioRxiv - Immunology 2023
Quote:
... human interleukin-2 (IL-2) (10 IU/ml, Roche), 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES ...
-
No products found
because this supplier's products are not listed.
Bergithe E Oftedal, et al.,
bioRxiv - Immunology 2020
Quote:
... 35% glycerol (Merck) and 0.05% Bromophenol blue (Merck ...
-
No products found
because this supplier's products are not listed.
Dillon J. McGovern, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 35 gauge needles (WPI). Syringes were left in place for 10 min following injections to minimize diffusion ...
-
No products found
because this supplier's products are not listed.
Yu-Tzu Shih, Jason Bondoc Alipio, Amar Sahay,
bioRxiv - Neuroscience 2023
Quote:
... 35 μm cryosections were obtained (Leica) and stored in PBS (0.01% sodium azide ...
-
No products found
because this supplier's products are not listed.
David Böhringer, et al.,
bioRxiv - Biophysics 2023
Quote:
... Batch C) are mixed with 35 000 cells and transferred to a 35 mm Petri dish (Greiner AG, Austria). Samples are polymerized at 37°C for 60 minutes ...
-
No products found
because this supplier's products are not listed.
Jiao Wang, et al.,
bioRxiv - Immunology 2020
Quote:
... Recombinant human interleukin-15 (IL-15) and Fibroblast Growth Factor-basic (bFGF) were purchased from GoldBio. Recombinant Human RANTES (CCL5 ...
-
No products found
because this supplier's products are not listed.
Prenitha Mercy Ignatius Arokia Doss, et al.,
bioRxiv - Immunology 2019
Quote:
... resuspended in 35% Percoll (GE Healthcare) and centrifuged ...
-
No products found
because this supplier's products are not listed.
Favian A. Hatje, et al.,
bioRxiv - Cell Biology 2020
Quote:
... coated 35 mm culture dishes (Sarstedt) for 24 hours ...
-
No products found
because this supplier's products are not listed.
Raphael Vidal, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and 35 µl rSAP (NEB) were added and sample was incubated for at least 8 h at 37 °C ...
-
No products found
because this supplier's products are not listed.
Axel Pahl, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 35 µL of OneGlo reagent (Promega) were added and luminescence was read ...
-
No products found
because this supplier's products are not listed.
Ege Sarikaya, et al.,
bioRxiv - Genetics 2021
Quote:
... 21 and 35 days by Qiagen Fibrous RNeasy kit in accordance with the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Siyoung Choi, et al.,
bioRxiv - Bioengineering 2023
Quote:
... 35 mm glass-bottom dishes (VWR, US) were cleaned with 0.1 N NaOH ...
-
No products found
because this supplier's products are not listed.
Giuseppe Gangarossa, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Pre-adult OFA rats P25-35 (Charles River, L’Arbresle, France) were used for brain slice electrophysiology ...
-
No products found
because this supplier's products are not listed.
Liyun Chen, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... containing human SERPINB3 or pLV-C-GFPSpark vector (Sino Biological LVCV-35) containing mouse Serpinb3a GFP-tagged fusion proteins ...
-
No products found
because this supplier's products are not listed.
Maxime Chevée, et al.,
bioRxiv - Neuroscience 2023
Quote:
... C57BL/6J mice (35 males and 35 females) were acquired from Jackson Laboratory (Bar Harbor, ME; SN: 000,664) and maintained on an 8am/8pm 12-h reverse light cycle ...
-
No products found
because this supplier's products are not listed.
Hereroa Johnston, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 35 (Illumina HiSeq 100bp paired end replicates sampled hourly from 0-19 hours post fertilization) ...
-
No products found
because this supplier's products are not listed.
Yini Zhu, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... CD4 (Tonbo Biosciences, 35-0042), Foxp3 (Tonbo Biosciences ...
-
No products found
because this supplier's products are not listed.
Sadia Afrin, Mohammad Nazrul Islam Bhuiyan,
bioRxiv - Microbiology 2019
Quote:
... 35 cycles using a thermal cycler (BioRad) and amplification conditions were 94°C for 1 min ...
-
No products found
because this supplier's products are not listed.
Kameron Azarm, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 35 was generated using site-directed mutagenesis (Agilent) of the MycTRF1.WT plasmid using the sense oligonucleotide 5’-CGGGGCTGTGCGGCTGCTAGGGATGCCGACCCT– 3’ and the antisense oligonucleotide 5’– AGGGTCGGCATCCCTAGCAGCCGCACAGCCCCG –3’ ...
-
No products found
because this supplier's products are not listed.
Xiaoyuan Fu, et al.,
bioRxiv - Cell Biology 2019
Quote:
... cells were pretreated with interleukin 4 (IL-4) (Cat. # Z02925-10, GenScript) at a concentration of 5 ng/ml for 24h ...
-
No products found
because this supplier's products are not listed.
Wassim Elkhatib, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... T.adhaerens animals were placed on 35 mm culture dishes (Eppendorf) containing the pH 7.8 ASW solution ...
-
No products found
because this supplier's products are not listed.
Diego Urquia, et al.,
bioRxiv - Plant Biology 2020
Quote:
... we selected 35 individuals from Isabela and 35 from Santa Cruz (we included one random sample from each location ...
-
No products found
because this supplier's products are not listed.
Estela Cruvinel, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 35% BSA and 2 ug/mL Plasmocin (InvivoGen, USA). Cells were cultivated for 30 days under the described conditions before passaging as single cells to specific experiments.
-
No products found
because this supplier's products are not listed.
Grant D. Jones, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... and 35S was determined using a LS6500 Multipurpose Scintillation Counter (Beckman Coulter). IVT ...
-
No products found
because this supplier's products are not listed.
Jesse D. Rogers, et al.,
bioRxiv - Bioengineering 2020
Quote:
... interleukin-1β (IL-1β, Cell Signaling Technology), platelet-derived growth factor-BB (PDGF ...
-
No products found
because this supplier's products are not listed.
A. D. Nahmad, et al.,
bioRxiv - Immunology 2021
Quote:
... PCR was performed for 35 cycles using PrimeStar MAX (Takara). Primers used for these reactions can be found in Supplementary Table 1 ...
-
No products found
because this supplier's products are not listed.
Megi Rexhepaj, et al.,
bioRxiv - Biochemistry 2024
Quote:
... Anti-human Fc (Jackson ImmunoResearch) was diluted 1:50,000 in Intercept (TBS ...
-
No products found
because this supplier's products are not listed.
Marina Boudigou, et al.,
bioRxiv - Immunology 2021
Quote:
... recombinant human Interleukin-2 (rh IL-2) (20 ng/mL, ImmunoTools) subsequently referred to as primed stimulation ...
-
No products found
because this supplier's products are not listed.
Polymnia Georgiou, et al.,
bioRxiv - Neuroscience 2022
Quote:
A three-chambered box (40 cm length × 30 cm width × 35 cm height; Stoelting, IL) was used to measure the preference of mice to the light-paired compartment with the non-light paired compartment ...
-
No products found
because this supplier's products are not listed.
Carla Cuní-López, et al.,
bioRxiv - Neuroscience 2021
Quote:
... supplemented with 0.1 μg/ml of interleukin (IL)-34 (IL-34) (Lonza, Basel-Stadt, Switzerland), 0.01 μg/ml of granulocyte-macrophage colony-stimulating factor (GM-CSF ...
-
No products found
because this supplier's products are not listed.
Fynn M. Hansen, et al.,
bioRxiv - Systems Biology 2020
Quote:
HEK293 (human, DMSZ, ACC 635) and U2OS (human, American Type Culture Collection [ATCC], HTB-96) cell were cultivated in DMEM (Gibco ...
-
No products found
because this supplier's products are not listed.
George N. Llewellyn, et al.,
bioRxiv - Microbiology 2023
Quote:
... mouse-anti-human IgG Fc-HRP (Southern Biotech) was diluted 1:2000 in blocking buffer and added and plates were incubated for 2 hours at 370C ...
-
No products found
because this supplier's products are not listed.
Sam De Meyer, et al.,
bioRxiv - Systems Biology 2022
Quote:
... equipped with a 35 mm lens (AF-S DX Nikkor 35 mm F1.8G, Nikon Inc., USA) set at iso 200 ...