Labshake search
Citations for Agilent :
1 - 50 of 582 citations for Interleukin 35 IL 35 Human HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... 35 was generated using site-directed mutagenesis (Agilent) of the MycTRF1.WT plasmid using the sense oligonucleotide 5’-CGGGGCTGTGCGGCTGCTAGGGATGCCGACCCT– 3’ and the antisense oligonucleotide 5’– AGGGTCGGCATCCCTAGCAGCCGCACAGCCCCG –3’ ...
-
bioRxiv - Plant Biology 2020Quote: ... The separation was performed on a 35% phenyl siloxane column (30.0 m × 250 µm, 0.25 µm nominal) (Agilent HP-35, Part Number 19091G-133) as previously described ...
-
bioRxiv - Biochemistry 2023Quote: Samples were analyzed using a DB-35 column (Agilent Technologies). Information regarding additional technical specifications is available elsewhere [41,42].
-
bioRxiv - Neuroscience 2020Quote: ... human embryonic kidney cells 293 (HEK293; Agilent #240073) were calcium phosphate-transfected with the recombinant AAV2 plasmid and a 3-helper system ...
-
bioRxiv - Plant Biology 2022Quote: ... DB-35 MS column (Agilent; 30 m × 250 μm × 0.25 μm film) was used for gas chromatography ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primary antibody was applied for 35 mins and secondary antibody (Rabbit Envision K4003, Agilent) for 30 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... and heated for 3 minutes (35°-80°C) in a PCR machine (Agilent SureCycler 8800). Next ...
-
bioRxiv - Molecular Biology 2023Quote: ... Before sorting islet cells were filtered through a 35 µm filter and sorted using MoFlo Cytometer (Dako), where cells were gated according to forward scatter and then sorted based on endogenous fluorescence (Smelt et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... using the qualitative DNA Kit dsDNA Reagent 35-5000bp (Cat No. DNF-915, Agilent Technologies, Santa Clara, USA).
-
bioRxiv - Plant Biology 2022Quote: ... Helium was used as carrier gas at a constant flow rate of 2 ml s-1 and GC was performed on a 30 m DB-35 column (capillary column, 30 m length, 0.32 mm inner diameter, 0.25 μm film thickness, PN: G42, Agilent). The injection temperature was 230 °C and the transfer line and ion source were set to 250 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... The slides were steamed for 35 minutes with a pH 6 Dako Target Retrieval (Agilent Technologies, S169984-2) and permeabilized with 0.1% Triton X-100 (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2023Quote: ... Helium was used as carrier gas at a constant flow rate of 2 ml s-1 and GC was performed on a 30 m DB-35 column (capillary column, 30 m length, 0.32 mm inner diameter, 0.25 μm film thickness, PN: G42, Agilent). The injection temperature was 230°C and the transfer line and ion source were set to 250°C ...
-
bioRxiv - Biochemistry 2021Quote: ... The peptide separation was performed on a C18 reverse phase column (Agilent, Poroshell 120, 0.3×35 mm, 2.7 μL) with a linear gradient of 8-48% B over 30 min (A ...
-
bioRxiv - Biochemistry 2019Quote: Cells were plated at 35 000 cells per well in a 96-well XF cell culture microplate (Seahorse Bioscience). Cells were equilibrated for 1 h at 37 °C in bicarbonate-free IMDM media (pH 7.3 ...
-
bioRxiv - Microbiology 2024Quote: ... and then eluted on a reversed-phase analytical column (ZORBAX 300SB-C18, 0.5 x 35 mm, 3.5 µm, 300Å, Agilent Technologies). There LC separation proceeded at 25 µl/min flow rate through an 8 min gradient of 8– 30% solvent B ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL of each PCR reaction was electrophoresed using the ZAG 130 dsDNA Kit (75-20000 bp) or ZAG 110 dsDNA Kit (35-5000 bp) (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... Images were performed using a 35 mm Litzcage coil (Doty Scientific, Inc) on a 7T horizontal magnet (Agilent ASR 310) and (Bruker Biospin ...
-
bioRxiv - Biochemistry 2024Quote: ... The signals were obtained with 8 cm-1 spectral resolution (unless specified otherwise) by performing 35 consecutive readings per measurement in 4,000-650 cm-1 range using MicroLab PC software (Agilent Technologies) and further processed with Spectragryph (F ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the binding of small fragments (35-2000 bp) using a 2100 Bioanalyzer with an Agilent high-sensitivity DNA chip (Agilent Technologies).
-
bioRxiv - Plant Biology 2020Quote: ... The point mutation was introduced in the binary construct 35S-GFP-TOC159GM by using a site-directed mutagenesis kit (Agilent-QuikChangeII) with the primers TOC159S3F and TOC159S3R ...
-
bioRxiv - Microbiology 2019Quote: ... pBT270 was created by introducing the constitutive A1/04/03 promoter (35) and removing the trc promoter from pBT223 using the QuikChange Lightning Kit (Agilent Technologies) and the oligonucleotides OBT314 and OBT315 ...
-
bioRxiv - Plant Biology 2024Quote: ... We used a Zorbax SB-C18 5 μm 4.6 x 250 mm column at 35°C on a 1260 Infinity HPLC instrument with a fluorescence detector (Agilent Technologies, Santa Clara CA) using an excitation wavelength of 340 nm and emission wavelength of 510 nm ...
-
bioRxiv - Biochemistry 2020Quote: ... linear gradient from 5% to 35% ACN in 50 mM TEAAc pH 7 over 15 min at 50 °C, Agilent Technologies Series 1200 HPLC). The collected fractions were freeze dried 3 times ...
-
bioRxiv - Pathology 2021Quote: ... 4μL of completed PCR products were analyzed using a Fragment Analyzer 5200 fitted with 33 or 55cm electrophoresis capillaries loaded with matrix capable of resolving dsDNA between 35 and 1500bp (Advanced Analytics, Agilent, Santa Clara, CA, USA). Capillary absorbance traces were analyzed and converted into pseudo-gel images using PROSize 3.0 software (Agilent ...
-
bioRxiv - Biochemistry 2022Quote: ... ScFv-Fc were revealed thanks to a polyclonal α-human IgG HRP-conjugated Ab (P0214, Dako), diluted 1:10000 ...
-
bioRxiv - Neuroscience 2023Quote: ... were transfected into HEK293 cells (AAV293, Stratagene). After 3 days ...
-
bioRxiv - Neuroscience 2023Quote: ... were transfected into HEK293 cells (AAV293, Stratagene). After three days ...
-
bioRxiv - Neuroscience 2019Quote: ... and RepCap5 (Applied Viromics) were transfected to HEK293 cells (AAV293, Stratagene). After 3 days of incubation ...
-
bioRxiv - Biophysics 2023Quote: ... Respirometry on HEK293 cells were performed on a SeaHorse XF Pro (Agilent) using the real-time ATP rate assay kit (103591-100 ...
-
bioRxiv - Immunology 2022Quote: E382R/S/A mutations were introduced into IgG1 Fc encoded within a pFUSE-hIgG1-Fc vector using site-directed mutagenesis (QuikChange II kit, Agilent), using mutagenic primers (Supplementary Table 4 ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV recombinant vector was produced using HEK293 T-cells (AAV293; 240073, Agilent Tech, CA, USA) cultured in 15 cm dishes (Corning ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV recombinant vectors were produced using HEK293 T cells (AAV293; 240073, Agilent Tech, CA, USA) cultured in 15-cm dishes (Corning ...
-
bioRxiv - Neuroscience 2022Quote: ... pAAV plasmids were co-transfected with a pDP6 helper plasmid into HEK293-AAV cells (Agilent). Cells were lysed 72 h after transfection and viral particles were purified using Iodixanol gradient followed by separation ion-exchange chromatography (GE Healthcare) ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... The N322Q mutation was introduced into ACE2-wt-Fc and ACE2-T92Q-Fc using the QuikChange Lightning Site-Directed-Mutagenesis kit (Agilent Technologies, United States) according to the manufacturer’s instructions and the respective parental vector as template ...
-
bioRxiv - Cancer Biology 2023Quote: ... After performing Fc block by using blocking buffer (Dako, X0909), cells were stained by CD24 (Abcam ...
-
bioRxiv - Neuroscience 2020Quote: The MAPK/ERK pathway was assayed in HEK293 cells with the Elk1 trans-reporting system (PathDetect, Agilent). HEK293 cells were maintained in DMEM supplemented with 10% FBS ...
-
bioRxiv - Neuroscience 2021Quote: AAV1/2 viruses were produced by large-scale triple CaPO4 transfection of HEK293-AAV cells (#240073, Stratagene) as described previously (Van Loo et al. ...
-
Enhancing gene transfer to renal tubules and podocytes by context-dependent selection of AAV capsidsbioRxiv - Cell Biology 2023Quote: ... AAV9-CAG-tdTomato and AAV-KP1-CAG-tdTomato were produced in HEK293 cells (RRID: CVCL-6871, Agilent) by an adenovirus-free plasmid transfection method and purified by two rounds of cesium chloride density-gradient ultracentrifugation followed by dialysis as described previously.53 AAV9 and AAV-KP1 helper plasmids were provided by J ...
-
bioRxiv - Pathology 2020Quote: ... The self-complementary scAAV9-CB-SMN vector was produced by calcium phosphate transfection of HEK293-AAV cells (Agilent) with pAAV-CB-SMN[57] and pDF9 plasmids ...
-
bioRxiv - Neuroscience 2021Quote: ... shuttle plasmids were co-transfected with the pDF9 helper plasmid into HEK293-AAV cells (Agilent Technologies, Santa Clara, USA). Cells were lysed 72h following transfection ...
-
bioRxiv - Cancer Biology 2020Quote: ... Sections of human tumors were stained with mouse anti-human CD68 (Dako) and goat anti-human TSP-4 (AF2390 ...
-
bioRxiv - Cell Biology 2020Quote: ... incubated with a rabbit antibody against mouse Fc fragment (Dako Agilent Z0412) in PBS 0,1% BSA for 20 min at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... incubated with a rabbit antibody against mouse Fc fragment (Dako Agilent Z0412) in PBS 0,1% BSA for 20 min at room temperature ...
-
bioRxiv - Systems Biology 2019Quote: ... and human TTR (Dako) with standard curves of purified human RBP4 (72 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human universal RNA (Agilent) was used as a reference to standardise results between QPCR batches.
-
bioRxiv - Immunology 2021Quote: ... mouse anti-human CD3 (Dako) and mouse anti-HIV-1 P24 (Dako) ...
-
bioRxiv - Immunology 2021Quote: ... FITC anti-human CD44 (DAKO), Purified NA/LE mouse anti-human CD253 (BD Biosciences) ...
-
bioRxiv - Microbiology 2020Quote: Universal Human Reference RNA (Stratagene) was treated with RNase-Free DNase Set (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-human CD8 (DAKO), and mouse anti-human TAG72 (AB16838 ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-human CD3 (DAKO), mouse anti-human CD4 (DAKO) ...