-
No products found
because this supplier's products are not listed.
Axel Chemla, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 2-Chloroquinoline-3-carboxylic acid (Sigma-Aldrich, cat. no 688517), 4-Chloro-DL-phenylalanine salt (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Blanca Soler Palacios, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 µl of Dynabeads MyOne Carboxylic Acid (1 μm; ThermoFisher Scientific) were added at a concentration of 0.5 mg/ml to each of the samples ...
-
No products found
because this supplier's products are not listed.
Huamei Forsman, et al.,
bioRxiv - Immunology 2024
Quote:
... The HCA3R agonists IBC 293 (1-(1-Methylethyl)-1H-benzotriazole-5-carboxylic acid) and 3-hydroxy-octanoic acid (3-OH-C8) were from Tocris (Bristol, UK) and Cayman Chemical (Michigan ...
-
No products found
because this supplier's products are not listed.
Christopher Douglas, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Carlos J. Garcia, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Authentic standards of 3,7-Dihydroxy-5-cholan-24-oic Acid (chenodeoxycholic acid) and 3-Hydroxy-11-oxo-5-cholan-24-oic Acid (3-oxo-chenodeoxycholic acid) were purchased from Avanti Polar Lipids (Alabaster, AL, USA). The N-(3α,7α,12α-trihydroxy-5β-cholan-24-oyl)-glycine (glycocholic acid) ...
-
No products found
because this supplier's products are not listed.
Peter H. Culviner, et al.,
bioRxiv - Microbiology 2020
Quote:
... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
No products found
because this supplier's products are not listed.
Huan Du, et al.,
bioRxiv - Neuroscience 2021
Quote:
... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Goki Tsujimoto, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and 3-Mercaptopicolinic Acid (5 mM; Cayman chemical, 20895).
-
No products found
because this supplier's products are not listed.
Judit Gonzalvo, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... germanica adults using an antisense LNA (locked nucleic acid) probe conjugated to Digoxigenin (DIG) at the 5’ and 3’ ends (5’-DIG-GGAGGTCCCCCAGACCGGCACAGACCGAA-DIG-3’, Merck). Ovaries were dissected under Ringer’s saline ...
-
No products found
because this supplier's products are not listed.
Jamil Mahmud, et al.,
bioRxiv - Microbiology 2023
Quote:
... 5’-CGCCTTCGTTACAAGCATCG-3’; antisense, 5’-AAGAGCAAACGCATCTCCGA-3’), GAPDH (sense, 5’-ACCCACTCCTCCACCTTTGAC-3’; antisense, 5’-CTGTTGCTGTAGCCAAATTCGT-3’) using Green GoTaq master mix (Promega, Madison, WI) with C1000 Touch Thermal Cycler (Bio-Rad ...
-
No products found
because this supplier's products are not listed.
Romain D. Cazé, et al.,
bioRxiv - Neuroscience 2023
Quote:
D-AP5 (D-(−)-2-Amino-5-phosphonopentanoic acid) and SR 95531 (2-(3-Carboxypropyl)-3-amino-6-(4 methoxyphenyl) pyridazinium bromide) were purchased from Abcam, UK ...
-
No products found
because this supplier's products are not listed.
Laura Miguel-Romero, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 5’/3’RACE Kit (Roche) was used to amplify the RNA obtained and the final DNA was sequenced to obtain the +1 nucleotide of str ...
-
No products found
because this supplier's products are not listed.
Vaishali Aggarwal, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... P4HA2 was inhibited by using 20 μmol/L 1,4-dihydrophenonthrolin-4-one-3-carboxylic acid (1,4-DPCA) (SC-200758, Santa Cruz, USA). 1,4-DPCA ...
-
No products found
because this supplier's products are not listed.
Jana Hucklenbroich, et al.,
bioRxiv - Plant Biology 2021
Quote:
... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
No products found
because this supplier's products are not listed.
Marco S. Kaiser, et al.,
bioRxiv - Physiology 2021
Quote:
... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
No products found
because this supplier's products are not listed.
Kathleen E. McGrath, et al.,
bioRxiv - Cell Biology 2024
Quote:
... IL-3 (5 ng/ml, Peprotech), and cholesterol-rich lipids (40 mg/mL ...
-
No products found
because this supplier's products are not listed.
Charlotte M. M. Gommers, et al.,
bioRxiv - Plant Biology 2020
Quote:
1-Aminocyclopropane-1-carboxylic acid (ACC; VWR P10007) was dissolved in sterile water (10 mM stock ...
-
No products found
because this supplier's products are not listed.
Olaf Klingbeil, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 14-3-3 (Cell Signaling, 8312S, 1:1,000).
-
No products found
because this supplier's products are not listed.
Maria C. Sterrett, et al.,
bioRxiv - Genetics 2022
Quote:
... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
No products found
because this supplier's products are not listed.
Zhilei Zhao, David Tian, Carolyn S. McBride,
bioRxiv - Neuroscience 2020
Quote:
[2] GAL4d from pBPGAL4.1Uw (Addgene plasmid #26226)(Primers:ADdomain,forward,5’-caggcggccgccataTGCATGGATCCGCCAACTTC AACCAGAGTGG-3’, reverse, 5’-tatcgatagacgtca CTACTCCTTCTTTGGGTTCGG-3’; BD domain ...
-
No products found
because this supplier's products are not listed.
Hua Li, et al.,
bioRxiv - Cell Biology 2020
Quote:
... was amplified by PCR using the primers (5’-GGTTCCGCGTGGATCCATGTCTCATGCAGCCGAGCCA-3’ and 5’-GGAATTCCGGGGATCCTCAGGACTCCTCTTCAATGCTGA-3’) and cloned into BamHI site of pGEX-4T-1 expression vector (GE Healthcare) using In-Fusion HD Cloning System (Clontech) ...
-
No products found
because this supplier's products are not listed.
Wei Huang, et al.,
bioRxiv - Genetics 2023
Quote:
... 14-3-3 polyclonal antibody (Proteintech, Cat#14503-1-AP), and beta tubulin antibody (Abways Technology ...
-
No products found
because this supplier's products are not listed.
Almut Dufner, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... and anti-mouse CD40 antibody (5 µg ml-1; HM40-3, Biolegend), or anti-IgM F(ab’)₂ fragment (5 µg ml-1 ...
-
No products found
because this supplier's products are not listed.
Natalia Duque-Wilckens, et al.,
bioRxiv - Immunology 2024
Quote:
... the medium was enriched with recombinant murine interleukin-3 (IL-3; 5 ng/mL) and stem cell factor (SCF; 5 ng/mL) from R&D Systems, Minneapolis ...
-
No products found
because this supplier's products are not listed.
Buse Baran, et al.,
bioRxiv - Plant Biology 2024
Quote:
... Guide RNA sequences “5-CGUGUCACGACGGAGUGGAU-3” and “5-AUGUUGUAUGUGCCUAUACG-3” were synthesized by GenScript by adding the Cas12a scaffold sequence (5-UAAUUUCUACUCUUGUAGAU-3 ...
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
Rutger D. Luteijn, et al.,
bioRxiv - Immunology 2022
Quote:
... 3′3′-cyclic-di-AMP (3′3′ CDA) (Invivogen, cat. no. tlrl-nacda), 2′3′-RR c-di-AMP (2′3′-RR-S2 CDA ...
-
No products found
because this supplier's products are not listed.
Seth D. Reighard, et al.,
bioRxiv - Immunology 2020
Quote:
... Following enumeration using 3% acetic acid with methylene blue (StemCell Technologies), splenocytes were resuspended in phosphate-buffered saline and forty to sixty million cells were injected either intraperitoneally or intravenously (via retro-orbital injection under isoflurane anesthesia ...
-
No products found
because this supplier's products are not listed.
Kevin C. Wilkins, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 500 mM Auxin (Indole-3-acetic acid) in DMSO (Corning #25950CQC) or DMSO alone were added at a 1:1000 dilution to the media ...
-
No products found
because this supplier's products are not listed.
Coralie Hérent, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Cy-3 or Cy-5 (1:500, Jackson ImmunoResearch). Sections were counterstained with a fluorescent Nissl stain (NeuroTrace 435/445 blue ...
-
No products found
because this supplier's products are not listed.
Umit Akkose, et al.,
bioRxiv - Genomics 2020
Quote:
... and 1 μCi of [α-32P]-3’-deoxyadenosine 5’-triphosphate (cordycepin 5’-triphosphate, Perkin Elmer Life Sciences) in 1× terminal deoxynucleotidyl transferase buffer (New England Biolabs) ...
-
No products found
because this supplier's products are not listed.
Joke De Jaeger-Braet, et al.,
bioRxiv - Cell Biology 2021
Quote:
... the slides were washed in cold 3:1 ethanol:acetic acid and mounted in Vectashield medium with DAPI (Vector Laboratories).
-
No products found
because this supplier's products are not listed.
Zhiqing Zhang, et al.,
bioRxiv - Microbiology 2024
Quote:
... a Tat-encoding plasmid and the luciferase-encoding pNL4-3.Luc.R-E-vector (NIH HIV Reagent Program) at a 1:1:3 ratio using polyethyleneimine (PEI, Polysciences). After 8 hours ...
-
No products found
because this supplier's products are not listed.
Jia J. Li, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Slides were rinsed in tap water and dipped 3-5 times in 0.5% Acid Alcohol (Leica Biosystems 3803651), followed by rinsing in tap water and bluing with Scott’s Tap Water (Electron Microscopy Sciences 2607007 ...
-
No products found
because this supplier's products are not listed.
Heidi Ala-Salomäki, et al.,
bioRxiv - Neuroscience 2023
Quote:
ICC(3, 1) = (BMS-EMS)/(BMS+(k-1)*EMS),
-
No products found
because this supplier's products are not listed.
Nelson García-Vázquez, et al.,
bioRxiv - Biochemistry 2024
Quote:
... LC-3 (1:5,000, Novus Biological NB100–2220), p21 (1:1,000 ...
-
No products found
because this supplier's products are not listed.
Ana C. Sias, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and female (GRABDA2h, N =1; GRABDA2m, N = 3) Long Evans rats (Th-cre-littermates, N = 5; Gad-cre-, N = 2; Charles River Laboratories, N = 3) aged 7-9 weeks at the time of surgery were used to record dopamine release in the BLA across Pavlovian trace conditioning ...
-
No products found
because this supplier's products are not listed.
Jennifer S. Chen, et al.,
bioRxiv - Microbiology 2020
Quote:
... and 3 dpi by high content imaging (BioTek Cytation 5) configured with brightfield and GFP cubes ...
-
No products found
because this supplier's products are not listed.
John K. Mich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)
-
No products found
because this supplier's products are not listed.
Eleonora Grisard, et al.,
bioRxiv - Cell Biology 2021
Quote:
... rabbit anti-human 14-3-3 1/1000 (EPR6380, GeneTex), rabbit anti-human Lamp1 1/1000 (clone EPR4204 ...
-
No products found
because this supplier's products are not listed.
Lotfi Ferhat, et al.,
bioRxiv - Neuroscience 2024
Quote:
... or rabbit anti-vesicular zinc transporter 3 (ZnT-3; 1/500; Synaptic System, Goettingen, Germany) diluted in PB 0.12 M containing 0.3% Triton X-100 and 3% BSA ...
-
No products found
because this supplier's products are not listed.
Valentina Gandin, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... using the following two primer sequences (T7 Forward: 5’-TAATACGACTCACTATAGCGTCATC-3’; Reverse: 5’-TTGTCGCACGTTCGGTGTCG-3’) and purified with DNA Clean and Concentrator-5 Kit (Zymo Research, 11-302). dsDNA was converted to RNA with HiScribe™ T7 High Yield RNA Synthesis Kit (NEB ...
-
No products found
because this supplier's products are not listed.
Annelot C. M. van Esbroeck, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... After rinsing the membrane with TBS-T (3 × 5 min) and TBS (3 × 5 min) fluorescence was detected by scanning on the Odyssey CLx (LI-COR Biosciences).
-
No products found
because this supplier's products are not listed.
X. Rosa Ma, et al.,
bioRxiv - Neuroscience 2021
Quote:
... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
No products found
because this supplier's products are not listed.
Thillai V. Sekar, et al.,
bioRxiv - Bioengineering 2023
Quote:
... 1/3 for CD8+ selection (Miltenyi Biotec) and 2/3 for CD4+ subsets (both positive selection for CD4+CD25+cells and negative selection for CD4+CD25- cells Miltenyi Biotec) ...
-
No products found
because this supplier's products are not listed.
Suha Naffar-Abu Amara, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 3 and 5 and counted using a particle counter (Z1; Beckman Coulter, Inc.). Experiments were carried out in triplicate ...
-
No products found
because this supplier's products are not listed.
Peter Kilfeather, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 5% CO2 and then imaged on a FlexStation 3 Multi-Mode Microplate Reader (Molecular Devices) at 37°C ...
-
No products found
because this supplier's products are not listed.
Nina R. Montoya, et al.,
bioRxiv - Microbiology 2022
Quote:
... The plates were developed with TMB (3, 3’, 5, 5’ - Tetramethylbenzidine) ELISA Peroxidase Substrate (Rockland Immunochemical, Limerick, PA), and absorbance was measured on a plate reader at 655 nm.
-
No products found
because this supplier's products are not listed.
Benjamin N. Bell, et al.,
bioRxiv - Immunology 2021
Quote:
RBD antigen binding during selection rounds 3 and 5 was evaluated using a 1:1000 dilution of rabbit anti-His FITC secondary antibody (Bethyl Laboratories). RBD antigen binding during selection Round 4 was evaluated using a 1:1000 dilution of Streptavidin-Alexa Fluor 647 secondary (Jackson ImmunoResearch) ...