Labshake search
Citations for Lonza :
1 - 50 of 1302 citations for 1 3 Fluorophenyl 5 oxopyrrolidine 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Synthetic lethal targeting of TET2-mutant hematopoietic stem and progenitor cells by XPO1 inhibitorsbioRxiv - Cancer Biology 2022Quote: ... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
bioRxiv - Microbiology 2022Quote: ... EMEM (ATCC; MRC-5 and Calu-3 cells) (Lonza; Tb-1 Lu cells) or MEM (Gibco ...
-
bioRxiv - Biophysics 2021Quote: ... The WT and mutant genes were then amplified from these expression plasmids using the PCR primers 5’-GCGCTAGCAGCACCCATATGCCTGAG-3’and 5’-ACGAAGCTTTCAGTGGTGGTGGTGGT-3’and subcloned into the pMaxCloning vector (Lonza, VDC-1040) via NheI and BamHI sites to generate the pMax_WT_NEIL1 and pMax_Mutant_NEIL1 expression plasmids that were utilized throughout this analysis.
-
bioRxiv - Bioengineering 2021Quote: ... were used between passages 3-5 for paxillin experiments and culture medium was changed every 2-3 days (Lonza FBM Basal Medium supplemented with 2 v/v% fetal bovine serum (FBS) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Between 1×10^3 – 5×10^4 cells were re-suspended in 20μl Buffer P3 (Lonza) per reaction and quickly added to the Eppendorf tube containing the CRISPR/Cas9 gRNA RNP complex ...
-
bioRxiv - Bioengineering 2023Quote: ... Adipose-derived stem cells (Passage 3-5) (Lonza, Walkersville, MD, USA) were cultured in a basal medium consisting of DMEM/F12 ...
-
bioRxiv - Bioengineering 2020Quote: ... passage 3-5 AFC were dissociated and resuspended in EGM-2 (Lonza) at 4×105 cells/mL ...
-
bioRxiv - Bioengineering 2022Quote: ... GM-3TM Lymphocyte Growth Medium-3 (LGM-3™) (Lonza), Opti-MEM Serum-Free medium (Thermofisher) ...
-
bioRxiv - Neuroscience 2023Quote: Larvae were anesthetized with 0.02% ethyl 3-aminobenzoate methanesulfonate salt (Tricane, (E10521, Ethyl 3-aminobenzoate methanesulfonate) and mounted in 1% low melting point agarose (50100, Lonza) in a 60 mm x 15 mm petri dish ...
-
bioRxiv - Developmental Biology 2024Quote: ... Undigested and digested products were resolved in a 3% Metaphor 1:1 (Lonza)/agarose gel (Invitrogen ...
-
bioRxiv - Genomics 2020Quote: ... donors (passage 2-3; Lonza) were continuously passaged to replicative exhaustion in complete Endopan-2 supplemented with 2% FBS under 5% CO2 ...
-
bioRxiv - Biophysics 2021Quote: Commercially available primary human umbilical vein endothelial cells (HUVECs) (pooled, passages 3-5, Lonza, Basel, Switzerland) were grown in EGM-2 medium (Lonza ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting mixture was electrophoresed in NuSieve 3:1 agarose (Lonza 50091), and fragments sized 150-350 bp were excised and then purified using a MinElute Gel Extraction kit (QIAGEN 28604) ...
-
bioRxiv - Microbiology 2023Quote: ... The RNA was loaded onto a 2% NuSieve 3:1 agarose (Lonza), 1X MOPS ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR products were then loaded and migrated by electrophoresis on a 3% Tris-borate-EDTA (TBE) agarose gel supplemented with GelStar Nucleic Acid Gel Stain (Lonza) for approximately one hour ...
-
bioRxiv - Immunology 2021Quote: Commercially available human primary PTs from 6 donors (3 males and 3 females, Lonza Walkersville Inc) were expanded at passage 4 ...
-
bioRxiv - Biophysics 2021Quote: ... HUVECs (Lonza, expanded to passage 3) were transduced with GFP tagged VE-cadherin (65 ...
-
bioRxiv - Cell Biology 2022Quote: ... Electroporation with the CA-137 program was performed 3-5 min after this addition (Lonza Group AG). Following this ...
-
bioRxiv - Bioengineering 2022Quote: ... and 3% FBS (all from Lonza Biosciences), termed astrocyte medium ...
-
bioRxiv - Microbiology 2020Quote: ... 10 μg of RNA were fractionated on a 2% NuSieve 3:1 agarose (Lonza), 1X MOPS ...
-
bioRxiv - Microbiology 2023Quote: ... 10 μg of RNA were fractionated on a 2% NuSieve 3:1 agarose (Lonza), 1X MOPS ...
-
bioRxiv - Microbiology 2023Quote: ... with a final concentration of 2% formaldehyde and 2% NuSieve 3:1 agarose (Lonza). 5 µg RNA was denatured for 10 min at 70 °C with 1 X MOPS buffer (20 mM MOPS ...
-
bioRxiv - Microbiology 2024Quote: ... 10 μg of RNA were fractionated on a 2% NuSieve 3:1 agarose (Lonza), 1X MOPS ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Dry powder (2-3 mg) was loaded into an HPMC size 3 capsule (VCaps® Plus, Lonza, Morristown, NJ). The capsule was placed in a Plastiape high resistance RS00 DPI that was then attached to a Next Generation Impactor (NGI ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Immunology 2022Quote: ... supplemented with fetal calf serum (FCS, 3%, Lonza) and HEPES (1.8%) ...
-
bioRxiv - Immunology 2022Quote: ... supplemented with fetal calf serum (FCS, 3%, Lonza) and HEPES (1.8% ...
-
bioRxiv - Microbiology 2023Quote: ... and 3 ml of ACK lysis buffer (Lonza) was added to the cells and incubated for 5 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3% MetaPhorTM Agarose gels (Cat. No. 50181, Lonza) were used ...
-
bioRxiv - Neuroscience 2024Quote: ... were nucleofected into 3 million cells by LONZA 4D-Nucleofector using program CB-150 ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells in passage 1 were trypsinized and resuspended (3 × 104 cells/mL) in BEGM** (Lonza, see Table S4 for details of media composition ...
-
bioRxiv - Genetics 2020Quote: ... ∼1×106 cells were transfected with pairs of 5 µg gRNA plasmid and 4 µg ssODN (Supplementary Table 3) using AmaxaTM Human CD34 Cell NucleofectorTM Kit (Lonza) in the 2B-NucleofectorTM on the U-08 setting ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... ∼300 pairs of ovaries were dissected from 3-6 day old females in 1× PBS (Lonza) with 1 mM DTT (Sigma ...
-
bioRxiv - Neuroscience 2021Quote: ... embedded in 3% agarose (Lonza, # 50004, Rockland, ME, USA) and coronally sectioned (Leica VT1000S vibratome ...
-
bioRxiv - Immunology 2021Quote: ... 1% nonessential amino acids (Lonza), 1 mM sodium pyruvate (Gibco ...
-
bioRxiv - Biochemistry 2023Quote: ... 1% 1xnonessential amino acids (Lonza), 50 μM 2-mercaptoethanol ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’) were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-100) using program A-30 in the XRep ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR products were resolved on 3% Metaphor agarose gel (Lonza), and DNA fragments of sizes approximately 150-200 nt were isolated from the gel using Qiagen’s Gel Extraction Kit (Figure 1D) ...
-
bioRxiv - Bioengineering 2020Quote: ... Cells were maintained in FGM-3 Medium (CC-4526, Lonza) and passaged at 80% confluence.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... CF patient# 3 (#28388-0000450918, Lonza, male, 25 years-old) and four non-CF donors with no pathology reported ...
-
bioRxiv - Neuroscience 2022Quote: ... brains were embedded in 3% agarose (SeaKem LE Agarose, Lonza). 150 μm thick vibratome sections (VT1000S vibratome ...
-
bioRxiv - Neuroscience 2022Quote: ... brains were embedded in 3% agarose (SeaKem LE Agarose, Lonza) and vibratome-sectioned (VT1000S vibratome ...
-
bioRxiv - Systems Biology 2024Quote: ... and finally resuspended in a cold SSC cocktail (3× Lonza AccuGENE SSC ...
-
bioRxiv - Microbiology 2022Quote: Sterile molten top NA (3 mL; 0.2 % SeaPlaque Agarose, Lonza) supplemented with CaCl2 and MgCl2 (both at 5 mM ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Biochemistry 2020Quote: ... 1% non-essential amino acids (Lonza) and 2 mM L-glutamine ...
-
bioRxiv - Microbiology 2022Quote: ... non-essential amino acids (1×, Lonza), penicillin (100 IU/mL) ...