Labshake search
Citations for Merck :
1 - 50 of 5041 citations for 1 3 Fluorophenyl 5 oxopyrrolidine 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... germanica adults using an antisense LNA (locked nucleic acid) probe conjugated to Digoxigenin (DIG) at the 5’ and 3’ ends (5’-DIG-GGAGGTCCCCCAGACCGGCACAGACCGAA-DIG-3’, Merck). Ovaries were dissected under Ringer’s saline ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... Birds from the anxiogenic group received 2.5 mg/kg of β-CCM (β-carboline-3-carboxylic acid-N-methylamide [FG 7142], Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) dissolved in DSMO (Dimethyl Sulfoxide suitable for HPLC ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... 3-Indoleacetic acid (IAA, auxin) (Merck, I2886) and 1-Naphthaleneacetic acid (NAA ...
-
bioRxiv - Neuroscience 2024Quote: ... 100 µM Trolox ([±]-6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid; Merck), 100 µM nocodazole and 1 nM NAP (a gift from Illana Gozes ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Neuroscience 2021Quote: RNAs with sequences 5’-AAGGAUGGAUGGAG-3’ (healthy) and 5’-AAGCAUGGAUGGAG-3’ (risk) were synthesised by Merck, resuspended in Ultrapure water ...
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-GCCCAAAGAATCAGAACAGATGC-3’) or the genomic 18S ribosome gene (mouse 18S forward: 5’-AAACGGCTACCACATCCAAG-3’, mouse 18S reverse: CAATTACAGGGCCTCGAAAG-3’) (Merck KGaA). Primers specific for mtDNA gives rise to a 201bp product ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Microbiology 2024Quote: ... The faecal slurries were aliquoted into tubes and 250 nM of ATTO 488-tagged Mission MicroRNA mimics (Sequence: 5’-[ATTO488]UCAACAUCAGUCUGAUAAGUCUA [dT][dT]-3’) and miR-21scr (Sequence: 5’-[ATTO488]AUCUUAUAACGACCGAAUAUUGC[dT][dT]-3’; both from Merck) were added ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Biochemistry 2020Quote: ... Prepared solutions were mixed at 3:1 ratio with 20% α-cyano-4-hydroxycinnamic acid (Merck) solution in 20% ACN ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and 0.15% 3-[(3- Cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS, Merck Chemicals Ltd.). NADH:decylubiquinone (DQ) ...
-
bioRxiv - Cancer Biology 2024Quote: ... proteins were subsequently alkylated with 20 mM Indole-3-acetic acid (Merck) for 1h at room temperature in the dark and diluted to 2M Urea ...
-
bioRxiv - Plant Biology 2020Quote: Inflorescences were harvested into fresh fixative (3:1 96% [v/v] ethanol [Merck] and glacial acetic acid) and kept overnight (O/N ...
-
bioRxiv - Microbiology 2022Quote: ... cells were fixed and permeabilized with a 3:1 mixture of methanol (Klinipath)-glacial acetic acid (Merck) for 10 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... air-dried at RT for 30 min and fixed in Methanol:Acetic acid in a 3:1 ratio (Merck) at 4°C overnight ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 3-nitro-L-tyrosine [5 µM] (Merck, Darmstadt, Germany) as internal standard (ISTD ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA oligonucleotide G4A4 (5’-AAAAAAGGGGAAAAGGGGAAAAGGGGAAAAGGGGAAAAAA-3’) was purchased from Merck. CD analysis of 2,5 µM RNA was carried out in the buffer used for G4-pulldown ...
-
bioRxiv - Neuroscience 2022Quote: ... was combined with 90μM sygRNA (5’ - GGATTTGGTAATAGCAG AGGGGG 3’) (Merck) at RT for 15 minutes to form an RNP complex ...
-
bioRxiv - Biophysics 2020Quote: ... Then His-tag containing OpuAC was introduced to the flow cell (in buffer B supplemented with 10 mM of (±)6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid (Trolox; Merck) as a photostabilizer[20] ...
-
bioRxiv - Microbiology 2024Quote: ... The chromatic mutants were mixed in different ratios (1:1, 1:3, 3:1) and the mixtures were fixed using 4% paraformaldehyde (Sigma−Aldrich/Merck, Germany) for 4 h at 4°C.
-
bioRxiv - Cell Biology 2022Quote: IBMX (3-Isobutyl-1-Methylxanthin – 15879 - Merck) and lidocaine (L7757 – Merck ...
-
bioRxiv - Neuroscience 2024Quote: ... and pyridine (Merck, Germany, 9:3:1) in a GC vial for GC–mass selective detector non-cholesterol and oxysterol analysis ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 µM IWR-1 (I0161, Merck) with 20 µM Y27632 ...
-
bioRxiv - Microbiology 2021Quote: ... + 3 μl benzonase (Novagen, Merck Millipore 70746-3), + 1 Roche complete protease inhibitor tablet) ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μM GSK-3 Inhibitor XVI (Merck, 361559) and 0.8 μM PD184352 (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2024Quote: ... Nucleic acids were labeled with 3 µM DAPI (Ex/Em: 352/464, Merck, Belgium) for 20 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... The AAV titer was quantified usizg PCR (5′-TGA GTC ACC CAC ACA AAG GA-3′ and 5′-CCA AGC TGG CCT AAC TTC AG-3′) after proteinase K treatment (Merck Millipore). Under anesthesia with a mixture of medetomidine (0.3 mg/kg ...
-
bioRxiv - Microbiology 2024Quote: ... 0.5 mL of a UPLC-grade water:methanol (3:1, v/v) solution with 1:500 diluted 13C-and 15N-labeled amino acids standard mix (Sigma-Aldrich, Merck, Darmstadt, Germany) was added to the tubes ...
-
bioRxiv - Neuroscience 2023Quote: ... The eluates 1-3 were mixed and concentrated with Amicon Ultra-15 (Merck Millipore, MWCO 3 K) to protein concentrations of 44–162 µM.
-
bioRxiv - Cell Biology 2021Quote: ... 0.5 mM 3-isobutyl-1-methylxanthine (Merck, I5879), 1 μM dexamethasone (Merck ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µL of Benzonase (Merck Millipore, US170664-3) was added and samples left on ice until an aqueous solution formed (30 min to 1 h) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3-NT (1:1000, 06-284, Merck) were used ...
-
bioRxiv - Neuroscience 2024Quote: ... or 3-NT (1:1000; 06-284, Merck). Following primary antibody incubation ...
-
bioRxiv - Biochemistry 2020Quote: The pure protein recovered after HPLC purification in 1% acetic acid was concentrated in Amicon Ultra-15 (cut-off 3 kDa) centrifugal filter units (Merck Millipore) to reach the final protein concentration of 1 mM ...
-
bioRxiv - Physiology 2024Quote: ... 5 min incubation at room temperature with 100 µL 1-Bromo-3-chloropropane (BCP) (Merck, Darmstadt, Germany, #B9673) was performed ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3% casein (Merck) in 20 mM TBS (pH 11.0) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Nutlin-3 (Merck) was dissolved in DMSO and diluted in saline.
-
bioRxiv - Plant Biology 2022Quote: ... a 70% ethanol solution containing 100 mM indole-3-acetic acid (IAA) (Merck KGaA, Darmstadt, Germany) was diluted 10,000 times in water to reach a final concentration of 10 μM IAA ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... in absolute ethanol (Thermo-Fischer; order code AJA214-2.5LPL) and 3 mL of propionic acid (Merck, Pty Ltd. ...
-
bioRxiv - Neuroscience 2020Quote: ... reverse: 5’-CCAGGGTGGAGCGGTC-3’) and the KOD Hot Start Mastermix (Merck, Darmstadt, Germany). The plasmids were confirmed by sequencing (Seqlab ...
-
bioRxiv - Biochemistry 2023Quote: ... PAPS (adenosine 3′-phosphate 5′-phosphosulfate, lithium salt hydrate) was purchased from Merck and stored at -80 °C to afford maximal stability.
-
bioRxiv - Developmental Biology 2021Quote: ... 0.1 M 3-Isobutyl-1-methylxanthine (IBMX; Merck, 15679), 50 mM DAPT (Merck ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved caspase-3 (1:1000; AB3623; Merck Millipore, USA), and interleukin 1β (IL1β ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved caspase-3 (1:1000; AB3623; Merck Millipore, USA), interleukin 1β (IL1β ...
-
bioRxiv - Cell Biology 2023Quote: ... 1:100 Phosphatase Inhibitor cocktail 3 (Merck, P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences ...