Labshake search
Citations for Agilent :
1 - 50 of 3930 citations for 1 3 Fluorophenyl 5 oxopyrrolidine 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Developmental Biology 2024Quote: ... By site-directed mutagenesis the V5 tag of the pMT-Bip V5-His A vector was replaced by a Myc sequence (EQKLISEEDL) using the primers: Fw: 5’– AGCGAAGAGGATCTGACGCGTACCGGTCATCAT–3 and 5’– AATCAGTTTCTGTTCGAATTCCACCACACTGGACTAGTAGGTACC–3’ and the PFU ultra (Agilent). The cDNA for Drospondin without the signal peptide sequence and the stop codon was amplified using the clone GH02025 from Drosophila Genome Resource Center (DGRC) ...
-
bioRxiv - Cell Biology 2024Quote: ... at 1:500 and 3-3’-diamino-benzidine-tetrahydrochloride (Dako, K3468). Stained sections were imaged using an NanoZoomer 2.0HT (Hamamatsu).
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Bioengineering 2021Quote: ... were extracted from freeze-dried sludge samples with a 3 h digestion time and 3% sulfuric acid and then analyzed by a gas chromatography-mass spectrometry (GC-MS) (Agilent, USA) with 7890A-5975C model (Lanham et al. ...
-
bioRxiv - Physiology 2020Quote: ... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were developed with 3′3-diaminobenzidine (DAKO Cytomation), following the manufacturer’s instructions.
-
bioRxiv - Physiology 2021Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation.
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Genomics 2020Quote: ... Ki67 (rat, DAKO M7249, clone TEC-3, 1:100), Carbonic Anhydrase 2 (rabbit ...
-
bioRxiv - Cancer Biology 2024Quote: ... (3) CD8 (Cytotoxic T Cells, 1:400, M7103; Dako)–Opal 570 ...
-
Dual MAPK and HDAC inhibition rewires the apoptotic rheostat to trigger colorectal cancer cell deathbioRxiv - Cancer Biology 2021Quote: ... Chromagen was developed using the DAB (3, 3-diaminobenzidine) reagent (Dako). Sections were counter-stained using pre-filtered Mayer’s haematoxylin (Amber Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Antigen–antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with haematoxylin (Dako ...
-
bioRxiv - Cell Biology 2020Quote: ... Antigen-antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with hematoxylin (Dako ...
-
bioRxiv - Physiology 2022Quote: ... Antigen–antibody complexes were revealed with 3-3′- diaminobenzidine (K346811, Dako) or the DAB (Polymer ...
-
bioRxiv - Cancer Biology 2024Quote: ... Antigen–antibody complexes were reveled with 3-3′-diaminobenzidine (K346811, Agilent). Sections were counterstained with hematoxylin (CS700 ...
-
bioRxiv - Microbiology 2021Quote: ... Tissue sections were colored via DAB-staining (3, 3-diaminobenzidine; Dako, K3468).
-
bioRxiv - Cancer Biology 2022Quote: ... 3’-Diaminobenzidine (DAB, Agilent) and then counterstained with haematoxylin (Abcam) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times (5 min) in TBST prior to addition of secondary antibody (goat anti-rabbit HRP 1:10,000; Dako - P00448). Blots were washed 3 times in TBST prior to development using SuperSignal West Pico Plus substrate (ThermoFisher ...
-
bioRxiv - Cancer Biology 2023Quote: ... in 3 cycles for 3 hours using the Seahorse XFe24 analyzer system (Agilent Technologies). Inhibitors and substrates were used at the following concentrations ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm column (Agilent), column temperature 50 °C ...
-
bioRxiv - Plant Biology 2024Quote: ... The digest was acidified to pH 3 with trifluoroacetic acid (TFA) and desalted using SampliQ C18 SPE cartridges (Agilent), according to the manufacturer’s guidelines ...
-
bioRxiv - Neuroscience 2021Quote: ... Lipids were resolved on a 3 150 mm XDB-C8 column (5 μM particle size) (Agilent) at flow rate 0.4 mL/min ...
-
bioRxiv - Molecular Biology 2020Quote: ... with a specific primer (5’-CCTACACGACGCTCTTCC-3’) using AffinityScript Multiple Temperature cDNA Synthesis Kit (Agilent Technologies). Then ...
-
bioRxiv - Neuroscience 2022Quote: ... and goat-anti-mouse IG (Dako, P0447, 1:3000 in 3% milk) antibodies were used ...
-
bioRxiv - Microbiology 2023Quote: ... Peptides were acidified with trifluoroacetic acid (TFA) to lower the pH below 3 and desalted on reversed phase (RP) C18 OMIX tips (Agilent). The tips were first washed 3 times with 100 µl pre-wash buffer (0.1% TFA in water/acetonitrile (ACN ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-diaminobenzidine (DAB) solution (Dako, USA) until signal was detected ...
-
bioRxiv - Cancer Biology 2022Quote: ... and KI67 (clone TEC-3, Dako) were then incubated on the tissue slices and bound antibody was detected with biotinylated goat anti-rat IgG (Southern Biotechnology) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’-diaminobenzidine tetrahydrochloride (DAB; Dako, K3467), as chromogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’ diaminobenzidine (DAB) (Dako, Carpinteria, CA) and counter-staining was done with hematoxylin ...
-
bioRxiv - Biochemistry 2023Quote: ... or a BIOSEC 3 column (Agilent; flow rate ...
-
bioRxiv - Bioengineering 2023Quote: ... PHA was extracted from lyophilized sludge using acidified methanol (3% sulfuric acid) containing chloroform and analyzed using a gas chromatography-mass spectrometry (Agilent, USA). Glycogen in sludge was extracted in a similar way but using 0.9M HCl and analyzed using a liquid chromatography-mass spectrometer (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: 3*10^3 of HPLFs per well were seeded into Seahorse XFe96 well plate (Agilent Technologies, 200941) for overnight ...
-
bioRxiv - Neuroscience 2021Quote: ... Next day membranes were washed for 3 x 5 min and incubated with HRP-coupled secondary antibodies (DAKO) diluted 1:3000 in washing buffer for 1.5 hour at RT ...
-
bioRxiv - Genetics 2023Quote: ... slides were carefully rinsed 3 × 5 min with PBS and slides were mounted with Fluorescent Mounting Medium (Dako) and examined under fluorescence using a Zeiss microscope equipped with an AxioCam HRm camera.
-
bioRxiv - Biochemistry 2021Quote: ... The digestion and desalting (total time 3 min) were driven by 0.4% formic acid (FA) in water pumped by 1260 Infinity II Quaternary pump (Agilent Technologies, Waldbronn, Germany) at a flow rate of 100 μL·min−1 ...
-
bioRxiv - Cell Biology 2024Quote: ... Step 3 was endogenous peroxidase blocking (Dako REAL Peroxidase-blocking reagent ...
-
Machine learning and data-driven inverse modeling of metabolomics unveil key process of active agingbioRxiv - Systems Biology 2024Quote: ... Gas separation was performed on the HP-5MS column (30 m 3 0.25 mm 3 0.25 mm, Agilent Technologies).
-
bioRxiv - Genomics 2022Quote: ... RT was performed with a specific primer (5′-CCTACACGACGCTCTTCC-3′) using AffinityScript Multiple Temperature cDNA Synthesis Kit (Agilent Technologies). RNA degradation was performed by incubating the RT mixture with 10% 1 M NaOH (2μl of RT mixture ...
-
bioRxiv - Biochemistry 2024Quote: ... 50 µl of the sample was injected onto a BioSEC-3 300 or BioSEC-5 1000 column (Agilent Technologies) pre-equilibrated with PBS or 10 mM histidine ...
-
bioRxiv - Biophysics 2022Quote: ... The samples were then further diluted in ultrapure water to a final 3% nitric acid concentration and analyzed by triple quadrupole inductively coupled plasma-mass spectrometry (Agilent 8800 ICP-QQQ). Copper concentrations were determined by using standard curves ...
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Cancer Biology 2021Quote: ... before staining at a previously optimised dilution (BCL-xL 1:500; cleaved Caspase 3 1:500; MCL-1 1:200) and visualised with Liquid DAB (Agilent, UK). Ki67 (Agilent #M7240 ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...