Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 1 3 Fluorophenyl 5 oxopyrrolidine 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... 3 µl of Dynabeads MyOne Carboxylic Acid (1 μm; ThermoFisher Scientific) were added at a concentration of 0.5 mg/ml to each of the samples ...
-
bioRxiv - Bioengineering 2022Quote: ... 5-norbornene-2-carboxylic acid (99%, Fisher Scientific) (12:1 to HA-TBA repeat unit) ...
-
bioRxiv - Biophysics 2022Quote: ... and PEG 20k (15% w/v) supplemented with 3 μM Alexa 546 dye (carboxylic acid, ThermoFisher). The protein solution consisted of 70 μM HMGA1a supplemented with 10 μM Alexa647-labelled HMGA1a ...
-
bioRxiv - Cell Biology 2023Quote: ... siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’, 5’-GGGAUGAUGAGACCAUGUAtt-3’, 5’- AAAUCCUAAUGGAGACAAAtt-3’, Ambion)
-
bioRxiv - Synthetic Biology 2023Quote: ... DynaBead MyOne carboxylic acid (Invitrogen), 1M MgCl2 (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
bioRxiv - Cell Biology 2021Quote: ... of Dynabeads M-270 Carboxylic acid (Invitrogen) by using a two-step coating procedure with EDC and NHS as indicated by the manufacturer ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 μm Dynabeads (Dynabeads MyOne Carboxylic acid #65011, Thermo Fisher Scientific) were added to the cells at a dilution of 1:20 ...
-
bioRxiv - Cell Biology 2020Quote: ... EndoB1 siRNA 5’-UGUUUAUACGACUUGGAGCUU-3’ and 3’-AAGCUCCAAGUCGUAUAAACA-5’ (Invitrogen), control siRNA (Ambion) ...
-
bioRxiv - Cell Biology 2023Quote: ... siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’) and siPATJ (5’-CCAGAUACUCACACUUCAGtt-3’, Ambion), siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’ ...
-
bioRxiv - Microbiology 2022Quote: 8-Hydroxyquinoline-2-carboxylic acid (98%, ACROS Organics) was dissolved in distilled water with pH adjusted to 10 using a solution of 1 M sodium hydroxide for better solubility ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Cell Biology 2024Quote: ... experiments were grown overnight in SDC at RT and then diluted in SDC and grown at 30°C for >4 h before being treated with either 500 µM 3-indole acetic acid (3-IAA; AID) for 1h or 1 µM estradiol + 1 µM 5-phenyl-IAA (5-Ph-IAA; Fisher Scientific) for 2h (grAID ...
-
bioRxiv - Developmental Biology 2020Quote: ... was captured using a GFP binding protein (GBP) covalently conjugated to carboxylic acid decorated Dynabeads (Dynabeads M-270 carboxylic acid, Thermo Fisher Scientific). Untagged SMO (Fig ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Immunology 2020Quote: ... and Alexa Fluor 647 Carboxylic Acid succinimidyl Ester (Invitrogen). Antibody labelling reactions were performed by incubating a mixture of secondary antibody ...
-
bioRxiv - Neuroscience 2022Quote: ... Dynabeads M-270 carboxylic acid (14305D, Thermo Fisher Scientific) were then added (2 µg/µl final concentration ...
-
bioRxiv - Cell Biology 2023Quote: ... and Alexa Fluor 647 Carboxylic Acid succinimidyl Ester (Invitrogen). Antibody labelling reactions were performed as previously reported (Borgman et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... the oligonucleotides 5’-CCTGTGCAGCCGTCCATAGGGCCTGTCAGTCAGTGGCCAAAACAGGCCTAT GAGGACGGCTGCAC-3’ and 5’-TGCTGTGCAGCCGTCCTCATAGGCCTGTTTTGGCCACTGACTGACAGGCCTATGGACGGCTGCA-3’ (#Mmi520981, Invitrogen) were used ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 micromols sodium sulfo-NHS and 5 micromols 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) (Thermo Fisher #22980) in 10 μL of DMSO ...
-
bioRxiv - Cell Biology 2020Quote: ... reverse: 5’-GGGGTCGGGAGGAACGG-3’ (Macrogen, South Korea) and beta-actin forward: 5’-CCTGGTCGGTTTGATGTT-3’ and reverse: 5’-GTGCGACGAAGACGA-3’ (Invitrogen, USA). Data analysis was made in CFX ManagerTM Software (BioRad ...
-
bioRxiv - Immunology 2021Quote: ... was added as the secondary antibody at a 1:2000 dilution for 1 h at 37C, followed by adding TMB (3, 3, 5, 5’-tetramethylbenzidine) peroxidase substrate (Thermo Scientific) for about 15 min ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Bioengineering 2021Quote: ... Dynabeads M-270 Carboxylic Acid were purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Biophysics 2022Quote: ... Alexa546 and Alexa647 carboxylic acid were obtained from Thermo Fisher. PEG 4000 and 6000 were from Sigma Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.01mg/ml Alexa Fluor 594 carboxylic acid (Thermo Fisher, A33082) was dissolved in the patch pipette solution ...
-
bioRxiv - Genomics 2020Quote: ... and 3 mL acid phenol:chloroform (Thermo Fisher). This mixture was heated to 65°C and shaken at 1400 rpm for 10 minutes followed by 5 minutes on ice ...
-
bioRxiv - Immunology 2022Quote: ... and valproic acid (3 mM, Acros Organics) were added to the cells immediately post-transfection to increase recombinant protein production ...
-
bioRxiv - Immunology 2023Quote: ... and valproic acid (3 mM, Acros Organics) were added to the cells immediately post-transfection to increase recombinant protein production ...
-
bioRxiv - Immunology 2024Quote: ... and valproic acid (3 mM, Acros Organics). The DNA/FectoPro amount was scaled proportionally depending on the size of the transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... or a 1:1 mixture of two siRNA to CHMP2A (5’-CAGGCCGAGAUCAUGGACAUG-3’ and 5’-GAAGAUGAAGAGGAGAGUGAC-3’) using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Plant Biology 2024Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-TGCTGTTCTCTGTGACTCTGGATCTGGTTTTGGCCACTGACTGACCAGATCC AGTCACAGAGAA-3’ and 5’-CCTGTTCTCTGTGACTGGATCTGGTCAGTCAGTGGCCAAAACCAGATCCAGAGTCACAGAGAAC-3’ (KD2) were obtained from Invitrogen, annealed ...
-
bioRxiv - Cell Biology 2022Quote: ... Guide RNA primer sets A (KS40 5’-ACCGACCACAGAAACTGCGACTAG -3’ and KS41 5’-AACCTAGTCGCAGTTTCTGTGGTC-3’) and B (KS42 5’-CCGTCCCACTGGCACCGCTTTATG-3’ and KS43 5’-AAACATAAAGCGGTGCCAGTGGGA-3’) were phosphorylated with T4 polynucleotide kinase (ThermoFisher) at 37°C for 30 min and annealed by cooling down from 85°C to 25°C at 0.1°C/sec ...
-
bioRxiv - Cancer Biology 2021Quote: ... carrying the mutation R273C was first amplified by PCR using the primers hp53-1 (5’-CACCATGGAGGAGCCGCAGTCAGATCC-3’) and hp53-8 (5’-GGATCCTCAGTCTGAGTCAGGCCCTTCTGTCTTG-3’) and cloned into the pENTR/D-TOPO vector (ThermoFisher) generating the entry vector pENTR p53(R273C ...
-
bioRxiv - Immunology 2022Quote: ... with siRNAs against SAMHD1 (sense RNA 5’-GCAGAUAAGUGAACGAGAUTT-3’, antisense RNA 5’-AUCUCGUUCACUUAUCUGCAG-3’) or the negative control #1 siRNA (Ambion). Three days after transfection with either siRNA or shRNA plasmids ...
-
bioRxiv - Neuroscience 2022Quote: ... the sgRNA sequence targeting exon 1 of Faah (5’-CTGCAGGCTAGGCAAACC-3’) and a control sgRNA sequence (5’-CTGCAGGCTAGGCAAACCTTT-3’ were synthesized (Invitrogen) and cloned into the shuttle plasmid for adeno-associated viral (pAAV-FLEX-SaCas9-U6-sgRNA;Addgene #124844 ...
-
bioRxiv - Microbiology 2023Quote: ... or alkaline phosphatase was added at a 1:2,000 dilutions for 1 h at 37ºC followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Scientific) or p-nitrophenyl phosphate (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2023Quote: ... siCT (5’- CGUACGCGGAAUACUUCGAtt-3’, Ambion), siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3-5 μL RNAiMAX (Invitrogen) were added to 500 uL serum-free RPMI-1640 and incubated at room temperature for 5 min ...
-
bioRxiv - Microbiology 2021Quote: ... mixed with forward and reverse detection primers (T3DCD S1 forward [5’- TACGCGTTGATCACGACAAT-3’] and T3DCD S1 reverse [5’- TGGCGAGATTATTCCCTGAC-3’] or GAPDH forward [5’- ACCCAGAAGACTGTGGATGG-3’] and GAPDH reverse [5’- GGATGCAGGGATGATGTTCT-3’]) and SYBR Select Master Mix (Applied Biosystems), and then subjected to PCR using the StepOnePlus Real-Time PCR system (Applied Biosystems) ...
-
The skin environment controls local dendritic cell differentiation and function through innate IL-13bioRxiv - Immunology 2021Quote: ... FW 5’-CTCTCTGGGCGAAATCTGCT-3’ and REV 5’-GAGTGCTTTCGCTATGTTGTTCA-3’ for Clmn and FW 5’-TGATGGGTGTGAACCACGAG-3’ and REV 5’-GCCGTATTCATTGTCATACCAGG-3’ for Gapdh using a QuantStudio 7 (Applied Biosystems). Transcript levels are expressed as the ratio of 2−ΔCT (Transcript of interest)/2−ΔCT (Gapdh).
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative RT-PCR on the mouse Zdhhc17 gene using primers spanning exons 1 and 2 (5’-ACCCGGAGGAAATCAAACCACAGA-3’ and 5’-TACATCGTAACCCGCTTCCACCAA-3’) and Sso/Advanced Universal SYBR green supermix (Fisher Scientific) was performed on CFX96 Real Time System (C1000 Touch Thermal Cycler ...
-
bioRxiv - Cell Biology 2024Quote: ... or Stealth siRNAs targeting coding sequences of human EZH2 mRNA (5′-GACCACAGUGUUACCAGCAUUUGGA-3′: EZH2 #1, and 5′-GAGCAAAGCUUACACUCCUUUCAUA-3′: EZH2 #2) were obtained from Thermo Fisher Scientific ...