Labshake search
Citations for Bio-Rad :
1 - 50 of 4793 citations for 1 3 Fluorophenyl 5 oxopyrrolidine 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed with C-kit variant 1 forward primer 5’-CAACAAAGAGCAAATCCATCCC-3’ and reverse primer 5’-CATCACAATAATGCACATCATGCC-3’ with iQ SYBR Green supermix (BioRad, Hercules, CA, Cat No. 1708882). The PCR program was as follows ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2024Quote: ... The hypervariable region V3–V4 of the bacterial 16S rRNA gene was amplified using the primers 338F (5’-ACTCCTACGGGAGGCAGCAG-3’)/ 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by using a T100 Thermal Cycler PCR thermocycler (BIO-RAD, USA). The PCR reaction mixture (20 µL ...
-
bioRxiv - Genomics 2023Quote: ... 5′-CCCCCCATCTGATCTGTTTCAC-3′) by qPCR using SsoFast EvaGreen Supermix (BioRad), according to the manufacturer’s protocol.
-
bioRxiv - Genetics 2022Quote: ... We washed the membrane 3× 5 minutes in TBS-T and 1× 5 minutes TBS before imaging (Bio-Rad ChemiDoc).
-
bioRxiv - Microbiology 2024Quote: ... and 0.25µM of each 5’ 6-FAM/ZEN/3’ IBFQ or 5’ HEX/ZEN/3’ IBFQ probe with the QX200 Droplet Digital PCR System (Biorad). Reactions were performed using the following PCR cycle settings ...
-
bioRxiv - Immunology 2023Quote: ... in non-reducing conditions and run at 120 V in 3-Morpholinopropane-1-sulfonic acid (MOPS) buffer (Bio-rad). Bands were visualized with Imperial Protein Stain (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... in non-reducing conditions and run at 120 V in 3-Morpholinopropane-1-sulfonic acid (MOPS) buffer (Bio-Rad). Bands were visualized with Imperial Protein Stain (Thermo Fisher Scientific) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Cancer Biology 2022Quote: ... 5’ - GAT GGA GAA AGC TCT GAG CAT C -3’ Reverse: 5’ - TTG CTC CAC AGA TGG AGT TG -3’ RHAMM PrimePCR primers were obtained from BioRad (Cat#: 10025636)
-
bioRxiv - Molecular Biology 2024Quote: ... and blocked in Odyssey PBS blocking buffer 1:3 in 1x PBS (Li-Cor, 927-40000) or EveryBlot blocking buffer 1:3 in 1x PBS (Biorad, 12010020) for 30 min (Odyssey ...
-
bioRxiv - Molecular Biology 2022Quote: ... using 10 mM CAPS buffer (3-[cyclohexylamino]-1-propanesulfonic acid [pH 11]) in a Mini Trans-Blot Electrophoretic Transfer Cell tank (Bio-Rad) according to protocol provided by the manufacturer ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed with TBS-T (3 × 5 minutes) and incubated in horseradish peroxidase (HRP)-conjugated secondary antibody (1:1000) (BioRad) in blocking solution for 1 hour ...
-
bioRxiv - Immunology 2024Quote: ... Membranes were washed with TBS-T (3 x 5 minutes) and incubated in horseradish peroxidase (HRP)-conjugated secondary antibody (1:1000) (BioRad) in blocking solution for 1 hour ...
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were washed with TBST 3 times for 5 minutes each before applying secondary fluorescent antibody (1:2,500, StarBright Blue 520 Bio-Rad) for 1 hour at room temperature ...
-
bioRxiv - Physiology 2024Quote: Native-PAGE gels (3% acrylamide:bis-solution 19:1 (BioRad, 1610144)/0.08% ammonium persulfate/0.006% tetramethylethylenediamine (TEMED)/1X TBE ...
-
bioRxiv - Plant Biology 2021Quote: ... membranes were washed 3 times 5 min with washing solution and incubated 1 h with anti-rabbit IgG HRP-conjugated secondary antibodies (Bio-Rad, 1:3000) at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
bioRxiv - Cancer Biology 2024Quote: ... WHO°3 n=3) using the Bio-Plex Cell Lysis Kit (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... the membranes were washed 3 times for 5 min and incubated with the secondary antibodies (1:10000, IgG-HRP, Bio-Rad) for 45 min at RT ...
-
bioRxiv - Immunology 2022Quote: ... then blocked for 1 to 3 hr at RT with 50 μL/well of blocking buffer (HN: 5% Blotting Grade Blocker, Bio-Rad cat ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Membranes washed 3 × 5 minutes in TBST then incubated in ECL reagent (BioRad, 170-5061) and imaged using a Chemidoc MP (BioRad) ...
-
bioRxiv - Microbiology 2023Quote: ... probe 5’-TGCAGTCCTCGCTCACTGGGCACG-3’ using the following conditions on a CFX96 Real Time PCR (Biorad): 50°C for 5 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibodies (Table 3) were diluted in 5% non-fat blocking milk (BioRad, Cressier, Switzerland) in TBST and incubated over night at 4°C with mild agitation ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μL of DNAse (1:3 in DNase buffer) (Biorad, 10042051) was added to 700 ng of RNA sample ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µL of DNAse (1:3 in DNase buffer) (Biorad, 10042051) was added to 700 ng of RNA sample ...
-
bioRxiv - Neuroscience 2023Quote: ... mixed 3:1 with 4x Laemmli buffer (Biorad, cat. no. 1610747) containing β-mercaptoethanol and heated at 95°C for 10 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 μL of DNAse (1:3 in DNase buffer) (Biorad, 10042051) was added to 700 ng of RNA sample ...
-
bioRxiv - Microbiology 2022Quote: ... 300 nM concentration of each primer targeting the viral DNA substrate (5’- AGCGTGGGCGGGAAAATCTC-3’) and the indicated target DNA (table 1) and 1X iTaq Universal SYBR Green Supermix (Bio-Rad Laboratories). The qPCR cycling conditions for quantifying INS activity included an initial incubation at 95°C for 3 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... 5% glycerol) 3 times and moved into a 25 mL Econo-Column Chromatography Column (Bio-Rad), where they were further washed with a minimum of 200 mL of wash buffer ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
bioRxiv - Neuroscience 2021Quote: ... All Blue Prestained Protein Standards (1-3 µl; BioRad Laboratories, Hercules, CA) were used to identify band molecular weights ...
-
bioRxiv - Microbiology 2022Quote: ... Ten micrograms of total RNA were separated on a 1% agarose gel containing 1X 3-(N-morpholino)propanesulfonic acid (MOPS) buffer and 2.2 M formaldehyde and transferred to a Zeta-probe membrane (Bio-Rad) by capillary transfer in 20X SSC buffer (3 M NaCl ...
-
bioRxiv - Molecular Biology 2022Quote: ... Ten micrograms of total RNA were separated on a 1% agarose gel containing 1X 3-(N-morpholino)propanesulfonic acid (MOPS) buffer and 2.2 M formaldehyde and transferred to a Zeta-probe membrane (Bio-Rad) by capillary transfer in 20X SSC buffer (3 M NaCl ...
-
bioRxiv - Microbiology 2023Quote: ... 1 µL primer 556R (5’ CTTTACGCCCARTRAWTCCG 3’) at 10 µM and 10 µL SYBER® Green Master Mix (Bio-Rad, Veenendaal, The Netherlands). The DNA extraction estimated an average rRNA yield corresponding to 5×10^8 bacterial cells/mL.
-
bioRxiv - Cell Biology 2024Quote: ... SARS-CoV2-PP were prepared by labelling with 0.4µM DiIC18(5) solid (1,1’-Dioctadecyl-3,3,3’,3’-Tetramethylindodicarbocyanine, 4-Chlorobenzenesulfonate Salt, or DID) (Thermo) with Biospin6 (Biorad) to remove residual dyes ...
-
bioRxiv - Cell Biology 2021Quote: ... Plates were incubated at 30°C for 3-5 days and photographs were taken by Chemi Doc (BioRad).
-
bioRxiv - Neuroscience 2022Quote: ... 40 μg of samples 3 were mixed with 2× laemmli buffer + 5% 2-mercaptoethanol (BioRad Laboratories, Hercules, CA). Samples were then briefly vortexed and centrifuged ...
-
bioRxiv - Synthetic Biology 2024Quote: ... was added into (Ribosome purification: 5 mL; PURE proteins purification: 2-3 mL) Econo-Pac chromatography columns (Biorad). The column was washed with 50 mL deionized Millipore water and charged with 15 mL 0.1 N Nickel sulphate solution ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...