Labshake search
Citations for GenScript :
3451 - 3500 of 6194 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... Individual peptides were ordered from Genscript and resuspended in DMSO (with a calculated final concentration of no greater than 10% ...
-
bioRxiv - Immunology 2022Quote: ... Omicron BA.1 and BA.5 was performed by GenScript, Nanjing ...
-
bioRxiv - Immunology 2022Quote: ... PDB 7RNJ (16)) and produced in house starting from synthetic DNA (Genscript). The human IgG-like bispecific CoV-X4042 was designed based on the variable regions of antibodies sd1.040 and rbd.042 in the CrossMAb format (25) ...
-
bioRxiv - Immunology 2022Quote: ... Four pcDNA3.1(+) mammalian expression plasmids for CrossMAb production were synthesized (Genscript), used to transfect Expi293F cells (ThermoFisher ...
-
bioRxiv - Immunology 2022Quote: ... starting from synthetic DNA (Genscript). The sequences corresponding to SARS-CoV-2 VOC were based on ...
-
bioRxiv - Immunology 2022Quote: ... and subcloned into an expression vector containing the human IgG1 or IgA1 Fc region by a commercial partner (Genscript). Transfection grade plasmids were purified by maxiprep and transfected into CHO cells ...
-
bioRxiv - Immunology 2022Quote: His tag-IP was performed using anti-His affinity resin (GenScript L00439-1) and Myc tag-IP was performed using anti-Myc affinity resin ...
-
bioRxiv - Immunology 2022Quote: ... The samples were then run on the Bolt 4–20% Bis-Tris Plus Gel (GenScript) and western blot was performed ...
-
bioRxiv - Immunology 2022Quote: ... or rabbit (GenScript, A00098, 1:2,000 diluted) IgG was added and then developed with 3,3’,5,5’ -tetramethylbenzidine (TMB ...
-
bioRxiv - Microbiology 2022Quote: ... The following antibodies were used: rabbit anti-GST (GenScript, A00097, 1:2000 for WB), rabbit anti-Flag (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... the pcDNA3.1+ plasmid encoding TMPRSS2-DYK was purchased from Genscript. All plasmids were sequence-verified before use with Sanger sequencing (Macrogen).
-
bioRxiv - Microbiology 2022Quote: ... comprising nominally 380 single mutants (stop codons were excluded) was synthesised by GenScript in vector pUC57Kan ...
-
bioRxiv - Microbiology 2022Quote: ... and 1 µM DrkBiT peptide (VSGWALFKKIS, synthesized by GenScript at >95% purity) was then prepared and added to wells in triplicate on four white 96-well plates (Greiner Bio-One) ...
-
bioRxiv - Microbiology 2022Quote: ... and the sfp gene was synthesized (GenScript, Nanjing, China). The other DNA fragment harboring a promoter (ttgacagctagctcagtcctaggtactgtgctagc ...
-
bioRxiv - Microbiology 2022Quote: ... were stimulated for 24 h with 15-mer overlapping peptides from SARS-CoV-2 spike glycoprotein (Cat no# PM-WCPV-S-1, JPT Peptide Technologies GmbH) or VSV-N (Genscript) at a concentration of 2.5 µg/mL ...
-
bioRxiv - Microbiology 2022Quote: ... Fifteen-mer overlapping peptides from SARS-CoV-2 spike glycoprotein (Cat# PM-WCPV-S-1, JPT peptides, Berlin, Germany) and MeV-nucleoprotein (Genscript, NJ, USA) were used to stimulate splenocytes at 5 µg/mL ...
-
bioRxiv - Microbiology 2022Quote: ... and rabbit anti-RTA (custom synthesized at GenScript, Inc.). Site-directed mutagenesis was performed in wt 8088sc (8088-wt ...
-
bioRxiv - Immunology 2022Quote: ... Fractions containing only trimeric rsHAtCh were then passed over G1 anti-FLAG-agarose resin (Genscript) equilibrated in 10mM Tris ...
-
bioRxiv - Immunology 2022Quote: RBD-CompA gene based on previously described amino acid sequence [24] was synthesized and cloned by Genscript in the pcDNA3.4+ vector.
-
bioRxiv - Immunology 2022Quote: All peptides were synthesized by Genscript at >95% purity with unmodified N- and C-termini.
-
bioRxiv - Biophysics 2022Quote: The gene that encodes human SERINC3 (Genscript-OHu02717D) was inserted upstream of a thrombin protease cleavable linker (LVPRGS ...
-
bioRxiv - Biochemistry 2022Quote: ... DABCYL-KTSAVLQSGFRKM-E(EDANS) (GenScript), was solubilized in 100% DMSO and aliquoted for storage at -80°C ...
-
bioRxiv - Biochemistry 2022Quote: ... The H163A mutant was generated in the background of this WT construct (GenScript).
-
bioRxiv - Biochemistry 2022Quote: ... as a C-terminal fusion to an N-terminal small ubiquitin-related modifier (SUMO) tag using BsaI and XhoI (GenScript, Piscataway, NJ, USA). This results in a construct that ...
-
bioRxiv - Neuroscience 2022Quote: ... and Beta Actin (1:2000, A00702, GenScript, Piscataway, NJ). Membranes were then washed and probed with horseradish-peroxidase-conjugated donkey anti-mouse or anti-rabbit IgG (H+L ...
-
bioRxiv - Plant Biology 2022Quote: ... PhnsLTP1+ PhnsLTP3-RNAi constructs were synthesized by Genscript. Before synthesis ...
-
bioRxiv - Cancer Biology 2022Quote: ... and the pcDNA3.1+-C-(K)-DYK plasmid expressing Flag-EBP was purchased from GenScript (#OHu18817). Primers for site-directed mutagenesis of the EBP gene were designed using the QuikChange Primer Design Program (https://www.agilent.com/store/primerDesignProgram.jsp?_requestid=1072141 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The desired constructs were synthesized and cloned into pUC57 (Ampr) using EcoRI and BamHI restriction sites by GenScript, transferred into the constitutive plant destination vector pK7FWG2 (bacterial Specr/plant Kanr ...
-
bioRxiv - Biochemistry 2022Quote: ... laevis GST-importin-α and GST-importin-β generated by GenScript and purified from serum according to previously published protocols (Alfaro-Aco et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... from various snake species were selected from NCBI databases and cloned into a mammalian expression vector containing a C-terminal Avi™ tag followed by a WELQut™ cleavage tag and a rabbit Fc tag by Genscript. Plasmid DNA was prepped and co-transfected with a plasmid expressing the BirA enzyme for in vivo biotinylation into Expi293 cells using FectoPRO® (Polyplus Transfection) ...
-
bioRxiv - Biochemistry 2022Quote: ... coli and synthesized in pUC57 by GenScript. The sequence corresponding to residues 1-239 was amplified by PCR using Q5 High-Fidelity DNA Polymerase (NEB) ...
-
bioRxiv - Biochemistry 2022Quote: ... was kindly donated by GenScript Biotech Corporation (Piscataway ...
-
bioRxiv - Bioengineering 2022Quote: ... coli and subcloned into pET-28a(+)-TEV vector between NdeI/XhoI restriction sites by Genscript (Piscataway, NJ). Genbank Accession Numbers of proteins tested in this study can be seen in Extended Data Table 1 ...
-
bioRxiv - Biochemistry 2022Quote: Gene 8 was synthesized and cloned into pet45b using the KpnI and BamHI sites by GenScript (Piscataway, NJ). The plasmids containing the L245A and L245C substitutions in gene 8 were also made by GenScript ...
-
bioRxiv - Biochemistry 2022Quote: ... The plasmids containing the L245A and L245C substitutions in gene 8 were also made by GenScript. The constructs ...
-
bioRxiv - Biochemistry 2022Quote: ... and polyclonal anti-histone H3 (A01502, GenScript, Piscataway, NJ). After washing three times with TBST buffer ...
-
bioRxiv - Biochemistry 2022Quote: An endoglycosidase H (EndoH) gene from Streptomyces plicatus was synthesized (GenScript) for recombinant expression in E ...
-
bioRxiv - Bioengineering 2022Quote: ... coli K5 and codon optimization was done (GenScript). The primers used for amplifying different gene fragments and the associated restriction sites are shown in Table 3 ...
-
bioRxiv - Bioengineering 2022Quote: ... for non-degradable gels) or mixtures of PEGSH and protease-degradable peptide (VPM peptide, GCRDVPMSMRGGDRCG, purity 96.9%, Mw 1696.96 Da, GenScript; for degradable gels). SFs were mixed with the protein and PEGMAL before addition of the crosslinker ...
-
bioRxiv - Bioengineering 2022Quote: ... The rat Arc 5’ UTR sequence was synthesized by Genscript. Molecular cloning techniques (PCR amplification ...
-
bioRxiv - Genetics 2022Quote: ... was synthesised by GenScript (Piscataway, NJ, USA). The sequence was subcloned into a modified pET32a vector (Novagen ...
-
bioRxiv - Bioengineering 2022Quote: ... was designed (Genscript) for production of an N-terminal hexahistidine tagged GRFT with an enterokinase cleavage site after the tag (14.5 kDa) ...
-
bioRxiv - Bioengineering 2022Quote: ... coli codons (Genscript). A second version ...
-
bioRxiv - Bioengineering 2022Quote: ... a thiolated RGD peptide (GCGYGRGDSPG, 1 mM, GenScript), lithium acylphosphinate photoinitiator (LAP ...
-
bioRxiv - Cancer Biology 2022Quote: ... and GLIS2C265G vectors were generated by synthesizing the full-length genes into an empty MIC digested with EcoRI/XhoI (GenScript, Piscataway, NJ, USA). The MSCV-Luciferase-IRES-NrasG12D vector (Nras ...
-
bioRxiv - Biochemistry 2022Quote: The wild-type bovine MRP4 gene and the MRP4E1202Q mutant were synthesized by Genscript and cloned into pFastBac with a C-terminal thrombin-cleavable 8xHis tag ...
-
bioRxiv - Cancer Biology 2022Quote: ... Plasmid construction and validation were performed by GenScript (Genscript Biotech Corp, Piscataway, NJ). BL21 (DE3 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Plasmid construction and validation were performed by GenScript (Genscript Biotech Corp ...
-
bioRxiv - Biochemistry 2022Quote: ... Fluorescein amide-labeled SSB C-terminal peptide (5-FAM WMDPDDDIPF) was synthesized and purified commercially (GenScript).
-
bioRxiv - Biochemistry 2022Quote: ... vinculin E28K/D33H/D110H/R113E/N773I/E775K (V1ab4) were synthezied and subcloned in the NcoI site of pET-3d by Genscript. cDNAs encoding for vinculin 879-1066 (Vt) ...