Labshake search
Citations for GenScript :
3301 - 3350 of 6194 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... the knockout strain was transformed by electroporation with each of the Kpn1/Xho1-digested pET-45b(+) expression vectors (GenScript Biotech, Netherlands), containing the single glutamine synthetase variants and selected by addition of 50 μg/mL kanamycin and 100 μg/mL ampicillin to the minimal medium ...
-
bioRxiv - Molecular Biology 2022Quote: ... pcDNA3.1-GFP-ACE2 expressing ACE2 SNPs were synthesized by GenScript. To generate SARS-Cov-2 pseudovirus ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cDNA encoded the SARS-CoV-2 PLpro with mammalian codon optimization was also ordered from GenScript and cloned into the pcDNA 3.1 with an C-terminal FLAG tag ...
-
bioRxiv - Molecular Biology 2022Quote: ... which was synthesized by GenScript. Reactions were performed in a total volume of 120 μL ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli codon optimization was ordered from GenScript and cloned into the pET15b expression vector with an N-terminal 6 × His-SUMO2 fusion tag ...
-
bioRxiv - Molecular Biology 2022Quote: ... and ordered from GenScript. The mutants used in this study were constructed by site mutation PCR and verified with sequencing.
-
bioRxiv - Molecular Biology 2022Quote: ... (GenScript, Piscataway NJ) and introduced into standard high-copy plasmids ...
-
bioRxiv - Molecular Biology 2022Quote: ... were synthesized by GenScript Inc ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA templates for uridine-depleted artificial sequences (RNA7, RNA8, RNA9) were also synthesized by GenScript and introduced into standard high-copy plasmids ...
-
bioRxiv - Molecular Biology 2022Quote: ... alpha-factor peptide (GenScript) was added to a final concentration of 5 µg/ml for 1.5 hours ...
-
bioRxiv - Molecular Biology 2022Quote: The coding sequence for E.coli glutamine synthetase (GS) was inserted into the Kpn1/Xho1-digested pET-45b(+) expression vector (GenScript Biotech, Netherlands), containing a hexahistidine tag at its N-terminus and ampicillin resistance gene on the plasmid ...
-
bioRxiv - Plant Biology 2022Quote: ... ABCG34 (At2g36380) and ABCG35 (At1g15210) cDNAs were custom synthesized by GenScript Biotech (Netherlands ...
-
bioRxiv - Neuroscience 2022Quote: ... we custom synthesized a codon-bias optimized Drosophila melanogaster β-tubulin85D gene in which S172 and T219 were mutated to either glutamate (E) or alanine (A) (GenScript, Piscataway, NJ). Each synthesized gene was FLAG-tagged at the C-terminus and subcloned into pUAST-attB ...
-
bioRxiv - Plant Biology 2022Quote: ... was synthesised by GenScript. To facilitate sub-cloning ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA was synthesized in pcc1-pbrick plasmid between cauliflower mosaic virus promoter (CaMV) 35S promoter and CaMV PolyA terminator de novo by GenScript, Piscataway ...
-
bioRxiv - Neuroscience 2022Quote: ... A matching clone in which all TAG triplets in the 3’-UTR were mutated to TGA to disrupt the Musashi binding sites was created using gene synthesis (Genscript). Gibson assembly was used to reclone the cDNAs into pcDNA3.1(+ ...
-
bioRxiv - Neuroscience 2022Quote: ... codon optimized mouse Pcbp2 clone with N-terminal Flag epitope tag was produced by gene synthesis (Genscript) and cloned in pcDNA3.1 (Invitrogen).
-
bioRxiv - Plant Biology 2022Quote: ... the MMV L gene from 2893 nucleotides-ST-LS1-pJL89 terminator in pUC57 was synthesized de novo by GenScript. To generate pJL-L-intron ...
-
bioRxiv - Microbiology 2022Quote: ... A construct composed of a hygromycin resistant gene (hygR) flanked by 500 bp upstream and downstream of rv3645 was synthesized (GenScript) and electroporated into Mtb expressing the recombinase RecET ...
-
bioRxiv - Microbiology 2022Quote: UrDGAT2 (GenBank accession number: AAK84179.1) was synthetized and codon optimized by Genscript. The gene was cloned under the pTEF promoter between BamHI and AvrII cloning sites in the overexpression JMP62 vector (Nicaud et al ...
-
bioRxiv - Molecular Biology 2022Quote: DNA encoding aa 403-1390 of ATAD2 was PCR amplified from the full-length codon-optimized synthetic ATAD2 gene (Genscript), and subcloned into an in-house modified pFastBac1 vector with an N-terminal 3xFlag tag and Tev protease cleavage site using EcoRI and XhoI restriction sites ...
-
bioRxiv - Molecular Biology 2022Quote: ... The construct was synthesized by Genscript, USA in pBluescript II SK (+ ...
-
bioRxiv - Molecular Biology 2022Quote: To determine the binding affinity of a TF-ARM peptides (synthesized by Genscript) with 7SK RNA ...
-
McIdas localizes at centrioles and controls centriole numbers through PLK4-dependent phosphorylationbioRxiv - Molecular Biology 2022Quote: ... The C-terminal region of McIdas (314-385 aa) was amplified from a synthetic and codon optimized gene purchased from GenScript, and cloned into pET20b(+ ...
-
bioRxiv - Molecular Biology 2022Quote: ... The DELE1 cDNA was from GenScript. The anti-eGFP monoclonal antibody (F56-6A1.2.3 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and AALA mutant were produced as GST-fused proteins by cloning the encoding ORF sequences into the pGEX-6P-1 plasmid (GenScript).
-
bioRxiv - Microbiology 2022Quote: ... The HsDGAT2 cDNA clone (NM_032564) was bought from Genscript and was amplified with the same primers as for MmDGAT2 (one nucleotide difference and no change in the amino acid sequences ...
-
Dual targeting factors are required for LXG toxin export by the bacterial type VIIb secretion systembioRxiv - Microbiology 2022Quote: ... and supplemented with 5uL of 0.1mg/mL competence stimulating peptide (DSRIRMGFDFSKLFGK, synthesized by Genscript). Cultures were then incubated at 37°C and 5% CO2 without shaking for 45 minutes (GC1825 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pylori 60190 nucleotide sequence (accession number U05676) and cloned into pUC57 (Genscript) in two overlapping parts ...
-
bioRxiv - Microbiology 2022Quote: ... recombinant human ACE2-IgG-Fc fragments (r-hACE2-Fc) (GenScript, Z03516) were firstly incubated with the Protein-G agarose (Millipore ...
-
bioRxiv - Molecular Biology 2022Quote: DNA representing wild-type full length p53 mRNA (NCBI Reference Sequence: NM_000546.6) was synthesized and cloned into pUC57 by Genscript. All DNA constructs were obtained by conventional PCR amplification using Platinum Taq DNA Polymerase (ThermoFisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pL7-PfSMC3-3HA-glmS plasmid also contained the homology repair construct 5’- AGATAGAGAGAGTTATATATCTAAAGGAACAAAGAATGAGGCCTACGAAATTATTAGC ATTGTATAAAAAAAAAAAGAAAAAAAAAAGAAAAAAAAAAAAGATTATATATATAAT ATATGTTGACAATTAATAAATATATTTGTATATATCTGTTAACTAATTATGAAAATTTTT GAATCAATAAATTTTTTAAATAACAAAAAAAAAAAAAAATATATATATTATATATATA TTTTATATTTTATATTTTCTTGTAATTTTTGTTTTTTTAGGAGGAAAAACATGCCCTAGA AAATggcggtggaTACCCTTACGATGTGCCTGATTACGCGTAtCCcTAtGAcGTaCCaGAcTAtG CGTACCCtTAtGAcGTtCCgGATTAtGCtcacggggtgTAAGCGGCCGCGGTCTTGTTCTTATTTT CTCAATAGGAAAAGAAGACGGGATTATTGCTTTACCTATAATTATAGCGCCCGAACTA AGCGCCCGGAAAAAGGCTTAGTTGACGAGGATGGAGGTTATCGAATTTTCGGCGGATG CCTCCCGGCTGAGTGTGCAGATCACAGCCGTAAGGATTTCTTCAAACCAAGGGGGTGA CTCCTTGAACAAAGAGAAATCACATGATCTTCCAAAAAACATGTAGGAGGGGACAACA ATTTGGTTTTGTTTTTTTCTTTAGGTTTTGAGAAAAACAAATAGGAAATACAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAATGTATTTTTACATATGCACTTGGATTA TTTTATTTTTATTATTTTTCTTTATATAAAGTAAAAATATACATAAGTATGCTTATTTATT ACATAAGAGTTTATTTAAGAAAGGTTTCTTTTTCATAATATTGTGTGCATGAGTTTTTTT TTATTTTATTTTTTTTTTTTATTTCTGTAACGAAAAGGATATTAAAAAAAATAATAAAA- 3’ (synthesized by GenScript Biotech [Piscataway, NJ, USA]). This homology repair construct comprises a 3 x Hemaglutinin (3HA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and recombinant mouse IL11 (rmIL11, UniProtKB: P47873) were synthesized without the signal peptide using a mammalian expression system by Genscript.
-
bioRxiv - Evolutionary Biology 2022Quote: ... These 89 consensus sequences were then synthesized by Genscript and cloned into the pGL3 Basic vector (Promega ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The full-length HesC coding sequence was synthesized in vitro by GenScript (Piscataway, NJ, USA) and subcloned (NCBI insert number ...
-
bioRxiv - Cell Biology 2022Quote: Wild type prkar2b subunit of bovine PKA and mutant prkar2b (harbouring mutations that ablate all potential miR-34c seed sites) were synthesized (GenScript) and cloned into pmaxGFP vector (LONZA) ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli optimized coding sequence for human FMRP (isoform 1) was designed and synthesized by Genscript, and then subcloned into pET His6 MBP TEV LIC cloning vector (1M) ...
-
bioRxiv - Microbiology 2022Quote: The sequence of MBaMV RBP and F open reading frame were synthesized by GenScript. These were cloned into pCAGGS vector cut by EcoRI and NheI-HF with adding HA tag (RBP gene ...
-
bioRxiv - Neuroscience 2022Quote: ... The peptides were synthesized by GenScript or Biomatik and dissolved at a concentration of 2 mg/ml in ice-cold coupling buffer (50 mM Tris ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse monoclonal (VWR GenScript A01622-40); western blot ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-V5 from GenScript and anti-GFP from Santa Cruz Biotechnology ...
-
bioRxiv - Biochemistry 2022Quote: ... and 0.05% Tween-20) followed by 120 sec baseline then association and dissociation of 100 μM peptide (GenScript) in assay buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... Various concentrations of H3K4me3 (1-21) substrate peptide (GenScript) were added with 1mM alpha-ketoglutarate to initiate demethylation by ∼1 μM KDM5C in 50 mM HEPES pH 7.5 ...
-
bioRxiv - Biochemistry 2022Quote: ... Chemical shift perturbation experiments were performed by obtaining HSQC spectra with increasing concentrations of histone tail peptides (GenScript) up to 1:5 molar ratio of PHD1:peptide ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 0.5 mg/mL Protein C peptide (GenScript), and 100 nM SE001 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 0.5 mg/mL FLAG peptide (GenScript), and 100 nM SE001 ...
-
bioRxiv - Immunology 2022Quote: Biotinylated TPI: HLA-DR1 was made by the NIH Tetramer Core facility (Atlanta, GA) with peptide (GELIGTLNAAKVPAD) purchased from GenScript. Divalent streptavidin was generously gifted by Dr ...
-
bioRxiv - Cell Biology 2022Quote: ... Proteins in SDS buffer were electrophoresed using gradient polyacrylamide gels (Genscript, #M00652). CHK-2 bands were excised and stored at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... Whole worm lysates were then separated on 4-12% polyacrylamide gradient gels (GenScript, #M00654), transferred to membranes ...
-
bioRxiv - Plant Biology 2022Quote: ... Peptides were obtained from Genscript and diluted to specified concentrations in sterile autoclaved water.