Labshake search
Citations for GenScript :
3601 - 3650 of 6194 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... Then gel electrophoresis was conducted at 120V for 90min using page gels (Genscript, M81615C), protein were then transferred to PVDF membranes (Bio-Rad ...
-
bioRxiv - Immunology 2021Quote: ... The splenocytes were stimulated for 20 hours at 37°C with RBD peptides (15-mer peptides overlapping by 9 amino acid spanning the RBD of SARS-CoV-2 spike protein, GenScript), at 5μg/mL of each peptide in RPMI + 10% FBS (R10) ...
-
bioRxiv - Immunology 2021Quote: Pseudo-neutralization assays were performed on hamster serum using the cPassTM Neutralization Antibody Detection kit (GenScript).
-
bioRxiv - Immunology 2021Quote: ... anti-NWSHPQFEK (NWS) tag-159Tb (clone 5A9F9, Genscript), anti-AU1-162Dy (clone AU1 ...
-
bioRxiv - Immunology 2021Quote: ... anti-Protein C tag-171Yb (clone HPC4, Genscript), anti-mCherry-142Nd (Abcam) ...
-
bioRxiv - Immunology 2021Quote: ... GST-tagged NSUN2 proteins were purified by affinity chromatography using reduced glutathione resin (GenScript, L00206) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... anti-Protein C tag-171Yb (clone HPC4, Genscript), anti-mCherry-142Nd (Abcam) ...
-
bioRxiv - Cancer Biology 2021Quote: K562 cells expressing luciferase were transfected with a plasmid containing full-length EGFR (#OHu25437D, GenScript) using lipofectamine 2000 according to the manufacturer’s protocol (Invitrogen) ...
-
bioRxiv - Cancer Biology 2021Quote: Genes were chemically synthesized by GenScript (Piscataway, NJ) and assembled into pcDNA3.1+ vectors (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... The “i6×7” intron (GenBank: AF179904.1 nucleotide 2988 to 3740) was synthesized by Genscript. The K18JAX (originally named K18i6×7PA ...
-
bioRxiv - Immunology 2021Quote: ... The endotoxin was removed using ToxinEraserTM resin (Genscript, Nanjing, China, cat#L00338) and the protein concentration was measured by BCA protein assay kit (TaKaRa ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3C protease (Prescission protease, GenScript, USA) was used in a 1:100 stoichiometric molar ratio to cleave the hexahistidine-tag ...
-
bioRxiv - Molecular Biology 2021Quote: ... Two Mpro gene constructs were ordered from Genscript, USA in a pET28a(+ ...
-
bioRxiv - Molecular Biology 2021Quote: ... cloned into the respective sites of pUC57 (GenScript; Piscataway, NJ). The fragments were then excised and cloned into the EcoRI and HindIII sites of the expression vector pBAD18 (61 ...
-
bioRxiv - Molecular Biology 2021Quote: ... All purification steps were monitored either by Coomassie-stained SDS-PAGE or anti-HIS western blot (Genscript #A00186). HMT assays were essentially performed as described in (Frapporti et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid constructions were conducted by GenScript (Piscataway, NJ, USA). The plasmids pGFP-P2A-CFTR-WT-T7 and pGFP-P2A-CFTR-Δex23-T7 encode recombinant GFP-P2A-CFTR proteins ...
-
bioRxiv - Molecular Biology 2021Quote: ... Size exclusion chromatography for phiLOV3 and TagRFP658 was performed by GenScript on a Superdex 200 10/300 GL column (GE Healthcare Life Sciences ...
-
bioRxiv - Molecular Biology 2021Quote: The genes of miRFP720 and miRFP670nano were de novo synthesized by GenScript using sequences reported in the original publications19,40 ...
-
bioRxiv - Molecular Biology 2021Quote: The mammalian codon-optimized genes of phiLOV2.1 and UnaG were synthesized de novo by GenScript based on the amino acid sequences reported in the original publications4,31 ...
-
bioRxiv - Molecular Biology 2021Quote: ... synthesized de novo by GenScript. The zebrafish codon optimized emiRFP2 gene was cloned by substituting the nucleotides encoding RpBphP1-based N-terminus of zebrafish codon optimized miRFP2 (aa 2-19 ...
-
bioRxiv - Molecular Biology 2021Quote: ... elephas VTG amino acid sequence deduced in silico (Fig. 1A) was used to create two synthetic peptides (Fig 1B) (Genscript USA Inc.) to be employed for the production of specific anti-VTG antibodies (Twin Helix ...
-
bioRxiv - Molecular Biology 2021Quote: ... using EcoRI/Xbal restriction sites (GenScript). The recombinant plasmid was transformed into P ...
-
bioRxiv - Developmental Biology 2021Quote: Putative SOX17-dependnent or TCF-dependent enhancers were synthesized (Genscript) and cloned into the pGL4.23 (luc2/miniP ...
-
bioRxiv - Developmental Biology 2021Quote: ... The fusion protein MBP-Hyx 1-176 was purified and injected into guinea pigs and the antibodies generated were purified by GenScript (Hong Kong).
-
bioRxiv - Developmental Biology 2021Quote: ... The full coding region of the hDTR gene (Genscript Clone ID OHu26607D) was PCR amplified with the following 5’ adaptor (attB ...
-
bioRxiv - Developmental Biology 2021Quote: Anti-ApoB-1 antibodies were generated by GenScript USA (Piscataway ...
-
bioRxiv - Microbiology 2021Quote: ... bacterial gasdermin genes used for in vivo assays were synthesized by Genscript Corp ...
-
bioRxiv - Microbiology 2021Quote: ... The predicted coding sequence for HV2 was synthesised (GenScript, Piscataway, NJ) after being codon-optimised for expression in human cells ...
-
bioRxiv - Microbiology 2021Quote: ... was synthesized by GenScript.
-
bioRxiv - Evolutionary Biology 2021Quote: BtKY72 RBD construct (BtKY72 S residues 318-520) was synthesized by GenScript into a CMVR plasmid with a N-terminal mu-phosphatase signal peptide and a C-terminal hexa-histidine tag (-HHHHHHHH ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The BtKY72 mutant S constructs T498W (BtKY72 S residue 487) and K493Y/T498W (BtKY72 S residue 482/487) were subcloned by GenScript from the BtKY72 S construct ...
-
bioRxiv - Evolutionary Biology 2021Quote: The remaining ACE2s were produced by Genscript. Specifically ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... affinis ACE2 (synthesized by GenScript) in OPTIMEM ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... affinis 9479 (GenBank: QMQ39227.1) ACE2 ectodomains constructs were synthesized by GenScript and placed into a pCMV plasmid ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 1:200 iFluor647-conjugated mouse anti-His (Genscript A01802) for civet ACE2 ...
-
bioRxiv - Biochemistry 2021Quote: ... the MERS-S gene in the antigenomic plasmid pVSV*ΔG(MERS-S) was replaced by a modified SARS-CoV-2 spike gene (Genscript, Piscattaway, USA) taking advantage of the flanking MluI and BstEII endonuclease restriction sites ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... BtKY72 mutant constructs T498W (BtKY72 S residue 487) and K493Y/T498W (BtKY72 S residue 482/487) were subcloned by GenScript from the BtKY72 RBD construct ...
-
bioRxiv - Evolutionary Biology 2021Quote: The BtKY72 S construct was synthesized by GenScript and cloned into an HDM plasmid with a C-terminal 3X FLAG tag ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Precise site saturation mutagenesis pools were produced by Genscript, provided as plasmid libraries ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Coding sequences from clpP1 cDNA from donor species (tobacco, S. conica, S. latifolia, and S. noctiflora) were commercially synthesized (GenScript, Piscataway, NJ) with the native tobacco regulatory elements and an introduced SphI restriction site and then cloned into pBS-v3 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Samples were mixed with 1X LDS Sample Buffer (GenScript) supplemented with 100 mM βME and incubated at 95 °C for 5 min ...
-
bioRxiv - Microbiology 2021Quote: ... A549 cells were transduced with codon-optimized human ACE2 (Genscript) cloned into pBABE-puro [54] (Addgene) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... simulansOr67a.P we generated a T2A-Gal4 targeting vector flanked by homology arms (1-1.1 kb) via gene synthesis (GenScript Biotech) as described [70].
-
bioRxiv - Evolutionary Biology 2021Quote: ... All cloning steps were carried out by GenScript, Inc.
-
bioRxiv - Developmental Biology 2021Quote: ... or the truncated version of Npnt containing only the N-terminal EGF-like repeats domain (Npnt-EGF) were commercially synthesized (Genscript) and cloned into the modified RCAS vector ...
-
bioRxiv - Developmental Biology 2021Quote: ... The α8β1 peptide inhibitor following the 23-mer sequence PRGDVFIPRQPTNDLFEIFEIER (Sato et al., 2009) was commercially generated (Genscript) and used at a 10 μM working concentration ...
-
bioRxiv - Neuroscience 2021Quote: ... #E5510S) of the Plppr4 ORF clone (NM_001001508.2) from GenScript (Piscataway, NJ, #SC1200) to introduce an N-terminal 3xHA tag 5’-ACCCATACGATGTTCCAGATTACGCTTACCCATACGATGTTCCAGATTACGCTTACC CATACGATGTTCCAGATTACGCT-3’ ...
-
bioRxiv - Neuroscience 2021Quote: ... Viral plasmids were obtained from GenScript with permission from Dr ...
-
bioRxiv - Neuroscience 2021Quote: ... scrambled C1.2 (AATRSTFASKTLIS) were synthesized with a Tat sequence (YGRKKRRQRRR) at the C-terminal by GenScript (Piscataway, NJ, USA). Scrambled sequences were confirmed to not match other protein sequences in mice by Blast search.
-
bioRxiv - Neuroscience 2021Quote: ... 1 μM CabTRP Ia (GenScript, Piscataway, NJ) was added to the saline ...