Labshake search
Citations for GenScript :
3051 - 3100 of 6194 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... enNTS1ΔM5B (M2044.60/M2084.64/M2445.45 M2505.51/M330L/M3527.36) and enNTS1ΔM4 (M2044.60/M2084.64/M2445.45/M2505.51/M3306.57/M3527.36) were purchased from GenScript (Piscataway, NJ) and subcloned into the expression vector pDS170 ...
-
bioRxiv - Biophysics 2022Quote: ... and pDS170 plasmids carrying the parent templates enNTS1ΔM10 (containing no methionine residues, purchased form GenScript, Piscataway, NJ) and enNTS1 (containing the full set of 10 methionine residues ...
-
bioRxiv - Biophysics 2022Quote: The codon-optimized gene encoding the nsp7-10 region of SARS-CoV-2 polyprotein was synthesized commercially (GenScript) and cloned between the NdeI and XhoI sites of pET15b vector ...
-
bioRxiv - Biophysics 2022Quote: ... coli was synthesized (Genscript). Nsp5 was cloned into pET His6 GST TEV LIC cloning vector (2G-T ...
-
bioRxiv - Biophysics 2022Quote: All the unmodified and acetylated histone peptides were purchased from GenScript (Piscataway, NJ, USA). The synthesized peptides were purified by HPLC to achieve 98% purity and present in lyophilized form with TFA salt ...
-
bioRxiv - Biophysics 2022Quote: ... construct cloned in a pGEX-6P-1 vector with an N terminal GST-tag followed by a precision protease site was obtained from GenScript.
-
bioRxiv - Biophysics 2022Quote: DNA fragments encoding the prf.GLFGN x12 variants in a codon-optimized form were synthesized by GenScript and cloned into a bacterial expression vector for overexpression and purification (see below) ...
-
bioRxiv - Cell Biology 2022Quote: ... The synthesis and cloning of this Flag and 6xHis tagged TgSORT coding nucleotide sequence in pPINKαHC were performed by Genscript based on P ...
-
bioRxiv - Cell Biology 2022Quote: Three subunits of the human mTORC1 complex (mTOR, Raptor, mLST8) were codon-optimized and synthesized (GenScript). The mTOR gene was cloned into a pCAG vector without a tag ...
-
bioRxiv - Cell Biology 2022Quote: ... flanking the EVT region (intron is between the N and G residues) and the KLH-conjugated antibody was purified by protein G column (GenScript USA Inc.). Samples were mounted in VECTASHIELD (Vector Laboratories ...
-
bioRxiv - Cell Biology 2022Quote: ... rat-anti-Sasshort (1:50, GenScript USA Inc.); mAb Cq4 against crumbs (1:100 ...
-
bioRxiv - Cell Biology 2022Quote: ... transferred to nitrocellulose membrane and the protein tags were detected by rabbit anti-BAP antibody (Genscript) and rat anti-HA antibody (Roche) ...
-
bioRxiv - Cell Biology 2022Quote: ... Mutated versions of genes for Y2H assay were commercially synthesized (Genscript).
-
bioRxiv - Cell Biology 2022Quote: ... samples were incubated with rabbit streptavidin antibody for 1 h (Genscript, A00621, 0.1 mg/mL). IgG and anti-streptavidin treated PS DAAM-particles were stained with donkey anti-rabbit-Alexa Fluor-647 antibodies (Invitrogen ...
-
bioRxiv - Developmental Biology 2022Quote: ... Transferred membranes were incubated with the following primary antibodies overnight at 4°C: DUXBL (1:1000, Custom antibody, GenScript), ZSCAN4C (1:500 ...
-
bioRxiv - Developmental Biology 2022Quote: ... DUXBL (1:500, custom antibody, GenScript), HDAC1 (1:100 ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-OLLAS 1:1000 (Genscript, A01658)) were added and incubated overnight in a humid chamber with a parafilm cover ...
-
bioRxiv - Developmental Biology 2022Quote: ... coli and purified by GenScript protein department ...
-
bioRxiv - Developmental Biology 2022Quote: To generate a custom rabbit polyclonal antiserum (GenScript), a poly-histidine tagged DUXBL fragment (aminoacids 193-350 ...
-
bioRxiv - Cell Biology 2022Quote: ... Protein was transferred to a PVDF membrane using eBlot L1 (Genscript). Blocking was performed with 5% milk in PBST (PBS + 0.1% TritonX-100 ...
-
bioRxiv - Cell Biology 2022Quote: ... coupled with a synthetic peptide of the sequence CQMPLLDSNTSHQIMDTNPDEEFSPNS (GenScript). This is amino acids 196-222 in the intracellular domain ...
-
bioRxiv - Cell Biology 2022Quote: The nourseothricin resistance cassette was ordered as a gene fragment from Genscript. Blasticidin S resistance was ordered as a gene fragment from Eurofins ...
-
bioRxiv - Cell Biology 2022Quote: ... pCDNA3.1-HCAR1-flag (Genscript) was used for C-terminal flag tagging ...
-
bioRxiv - Evolutionary Biology 2022Quote: Probe templates were synthesized in vitro (by GenScript) based on known full-length coding sequences (1-1.2 kb ...
-
bioRxiv - Cell Biology 2022Quote: ... coli using the pET28a vector (GenScript, USA). BDNF was diluted either in saline for in vivo experiments or in DMEM for in vitro experiments ...
-
bioRxiv - Cell Biology 2022Quote: ... The GST-RAPH1F2 construct (RAPH1 aa 535-868) was purchased from GenScript.
-
bioRxiv - Cell Biology 2022Quote: ... and F4 (RAPH1 aa 868-1062) constructs were purchased from GenScript. Briefly ...
-
bioRxiv - Cell Biology 2022Quote: ... Peptides were purchased from Genscript.
-
bioRxiv - Cell Biology 2022Quote: ... BNIP3_OMu13517D or Cdc42_OMu16203C_cDNA expression plasmids were synthesized by a commercial entity (GenScript USA Inc). NDRG1_OMu19504D and BNIP3_OMu13517D were each cloned into a pcDNA3.1+/C-(K)-DYK vector ...
-
bioRxiv - Cell Biology 2022Quote: Peptides encoding hit sequences were synthesized commercially (GenScript) with an added Tyr-Ala sequence at the N-terminus to facilitate quantification and used without further purification ...
-
bioRxiv - Cell Biology 2022Quote: ... Human HSPE1-GFP was cloned into pcDNA3.1 from the HSPE1 (NM_002157.2) ORF Clone (OHu17870D, Genscript). The HSPE1-GFP constructs were transfected into cells using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Cell Biology 2022Quote: ... The pcDNA3.1-eGFP-S plasmid was purchased from Genscript. We reconstructed pcDNA3.1 plasmids coding membrane ...
-
bioRxiv - Cell Biology 2022Quote: ... was inserted between Lys359 and Met360 in the TM3-TM4 intracellular loop of the β2 subunit by using the GenBuilder cloning kit (GenScript, catalog #: L00701). The construction of fluorescently tagged nAChR subunits were described previously [58 ...
-
bioRxiv - Cell Biology 2022Quote: ... IA) and human TOM1L2 (long isoform NP_001076437 gene synthesized by Genscript) were PCR amplified and cloned in FRT vectors with mNeonGreen (NG) ...
-
bioRxiv - Cell Biology 2022Quote: ... Plasmid vectors were purchased from GenScript (clone BAFF, OHu22261). Nucleofection (Nucleofector kit V ...
-
bioRxiv - Cell Biology 2022Quote: ... farciminis (GenBank accession number: CP012177.1) was constructed by GenScript company (Nanjing ...
-
bioRxiv - Cancer Biology 2022Quote: The open reading frames (ORFs) of INPPL1 (GenScript: OHu19348), MAP4K5 (GenScript ...
-
bioRxiv - Cancer Biology 2022Quote: ... MAP4K5 (GenScript: OHu02673), and various mutants of these genes were cloned into pLV-EF1a-IRES-Neo (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: sgRNAs were synthesized as complex oligonucleotide pools with several sub-pools (Genscript). Subpools were amplified with PCR ...
-
bioRxiv - Cell Biology 2022Quote: The full-length ORFs of all individual TFs were obtained from GenScript and cloned into lentiviral destination vector pLenti6/V5-DEST™ (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... The C-terminal BAP tag of localized mitosomal proteins was detected by a rabbit anti-BAP polyclonal antibody (GenScript). Mitosomal marker GL50803_9296 was detected by a rabbit anti- GL50803_9296 polyclonal antibody (3) ...
-
bioRxiv - Cell Biology 2022Quote: ... GiGrx5 and GiBolA proteins were detected by a rabbit anti-BAP polyclonal antibody (GenScript). Mitosomal GiTom40 and GiIscU were detected with a specific polyclonal antibody raised in rabbits (84) ...
-
bioRxiv - Cell Biology 2022Quote: ... The gRNA: ATAGTGCTCGCACTTGCAAC (designed in http://crispr.mit.edu/) was linked into the CRISPR Cas9 Plasmid (Genscript; Nanjing, China) and transform into competent cell (Trelief 5a ...
-
bioRxiv - Cell Biology 2022Quote: ... varying amounts of a crosslinker peptide (sequence CGPQGIAGQGC; GenScript, Piscataway, NJ, USA) and FluoSpheres 100 nm Yellow Green fluorescent beads (0.01% of gel volume ...
-
bioRxiv - Cell Biology 2022Quote: ... Endotoxin levels in all preparations were measured using ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit (GenScript, Piscataway, NJ, USA) and were less than 0.05 EU/ml.
-
SMDT1 variants impair EMRE-mediated mitochondrial calcium uptake in patients with muscle involvementbioRxiv - Genetics 2022Quote: ... or goat anti-rabbit (#A00160; Genscript Biotech, Piscataway, NJ, USA) in 2% (w/v ...
-
bioRxiv - Immunology 2022Quote: All peptides were synthesized at >95% purity by GenScript (Jiangsu, China), and verified using mass spectroscopy ...
-
bioRxiv - Immunology 2022Quote: ... synthesized (Genscript) and sub-cloned into a self-inactivating lentiviral vector under the EF1-a promoter ...
-
bioRxiv - Genomics 2022Quote: ... a 9 base pair(bp)’Spatial barcode A’,(3) a 12bp anchor sequence(/AmC6/CTACACGACGCTCTTCCGA-Spatial barcode A-ACTGGCCTGCGA) (Genscript). To enlarge the barcode pool ...
-
bioRxiv - Immunology 2022Quote: ... The SARS-CoV-2 spike glycoprotein expression constructs were synthesized by GenScript (Netherlands). Constructs bore the following mutations relative to the Wuhan-Hu-1 sequence (GenBank ...