Labshake search
Citations for GenScript :
2951 - 3000 of 6194 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: Untagged pEGBacMam-p22phox was amplified from OHu21427 (GenScript) by PCR and subcloned in pEGBacMam using In-Fusion seamless DNA cloning (Takara Bio) ...
-
bioRxiv - Immunology 2022Quote: ... and 5 μg protein per sample were separated in 10% SDS gels (SurePAGE Bis-Tris gels, GenScript) for approximately 10 min at 120 V ...
-
bioRxiv - Biochemistry 2022Quote: ... the DNA coding for the human LRRK1 residues 20 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCGCTGTGTGTCCAGAACGTGCCATGG and the reverse primer TATCCACCTTTACTGTCACCTTCTCTTGCGAGTGCAAGCCTCC ...
-
bioRxiv - Plant Biology 2022Quote: ... synthesized de novo by GenScript Corporation ...
-
bioRxiv - Microbiology 2022Quote: ... pcDNA3.1 encoding CoV-2 Omicron (BA.1) Spike tagged with a His epitope on the N-terminus was synthesized provided by Genscript. pMD2.G encoding VSV-G (12259 ...
-
bioRxiv - Genomics 2022Quote: ... Anti-Sloth1 and Anti-Sloth2 antibodies (1:1000) were raised in rabbits (Genscript, PolyExpress Silver Package).
-
bioRxiv - Biophysics 2022Quote: The 5Qβ/4PP7 slncRNA sequence was ordered from GenScript, Inc ...
-
bioRxiv - Microbiology 2022Quote: ... The N-terminal domain (Delta-like) of the SARS-CoV-2 Delta-Omicron recombinant spike was chemically synthesized as a short fragment (Genscript) and fused by overlapping PCR with the RBD and C-terminal parts of the BA.1 spike ...
-
bioRxiv - Genetics 2022Quote: ... PRDM9 (aa 1-416) and PRDM9dC (aa 1-371) were amplified from human cDNA purchased from GenScript (ORF Clone ID OHu03253). SETD2 (aa 1450-1645 ...
-
bioRxiv - Biophysics 2022Quote: Full-length human 2’-5’-oligoadenylate synthase 1 (OAS1) has been purchased from Genscript and cloned in the pRSF-Duet1 vector ...
-
bioRxiv - Biophysics 2022Quote: The full length human PARP1 cDNA cloned in pET28-a(+) was purchased from GenScript, USA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Protein G-Agarose beads (Genscript), Polyetheleneimine reagent (Polysciences ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... was commercially synthesized and subcloned (Genscript) into HindIII and BamHI sites of pSP64poly(A ...
-
bioRxiv - Cancer Biology 2022Quote: ... and purified with protein A resin (GenScript). Buffer replacement in protein purification used Column PD 10 desalting column (GE Healthcare) ...
-
bioRxiv - Biochemistry 2022Quote: ... For high-level expression we used the pESC plasmid (Genscript) and glucose was substituted for galactose ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ORF was synthesized (GenScript) and cloned into pPD133.48 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sangon Biotech) and RNA (5’-Cy5-ACGCGUCGCAGGCCU UUUUAUU-3’; 0.3 mM, final concentration; GenScript Biotech Corp.) in 50 μL annealing buffer (5 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sangon Biotech) and RNA (5’-GCGUCGCAGGCCUUUUUAUU-3’; 0.39 mM, final concentration; GenScript Biotech Corp.) in 50 μL annealing buffer (5 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2022Quote: ... was synthesized by GenScript and was generated by replacing the 12- and 12-RSSs of pTet-RSS (32 ...
-
bioRxiv - Molecular Biology 2022Quote: ... neoformans Gcn4 by GenScript. The secondary antibody used was horseradish peroxidase-conjugated anti-rabbit IgG (Cell Signaling Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... All vectors encoding truncated variants of NCL and full-length RPL26 were synthesized and cloned into pET-15b vector by Genscript. Proteins were expressed in Escherichia coli strain BL21(DE3)pLysS (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: Synthetically derived EPs were purchased from Genscript. Dried peptides were dissolved in ice-cold deionized water to a concentration of 500 μM and stored on ice until analyzed ...
-
bioRxiv - Molecular Biology 2022Quote: ... The genes for the designed HN protein variant 1 (HNv1) and F protein variant 1 (Fv1) were codon-optimized for expression in SJ and synthesized by Genscript® ...
-
bioRxiv - Molecular Biology 2022Quote: ... All SP sequences were synthesized by Genscript® and inserted into the expression vectors via restriction with HindIII and XhoI (Thermo Scientific™ FastDigest ...
-
bioRxiv - Molecular Biology 2022Quote: ... pFV4a-PB was synthesized by GenScript, and was derived from the Helraiser (HR ...
-
bioRxiv - Neuroscience 2022Quote: ... The purified proteins were made endotoxin free using the Toxineraser endotoxin removal kit (Genscript, Piscataway, NJ). For fibrillation ...
-
bioRxiv - Biochemistry 2022Quote: ... The hexahistidine tag and Sso7dmut were cleaved from HIV-1 IN by addition of his-tagged sortase and GGGC peptide (GenScript). The reaction was exposed to nickel resin to remove sortase and any residual uncleaved IN ...
-
bioRxiv - Biochemistry 2022Quote: ... and human CDC73 sequences with an N-terminal Flag tag were synthesized and sequences confirmed by GenScript. The human ubiquitin sequence with an inserted N-terminal cysteine residue was synthesized by Eurofins ...
-
bioRxiv - Biochemistry 2022Quote: ... and TNRC6A & TNRCB genes were purchased from GenScript. All cell lines were cultured in McCoy’s 5A medium (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2022Quote: ... which were synthesized from GenScript containing two gRNAs driven by U6b (AAEL017774 ...
-
bioRxiv - Bioengineering 2022Quote: ... Two GenPart fragments were synthesized from GenScript for each plasmid (OA-1053A or OA-1053B) ...
-
bioRxiv - Bioengineering 2022Quote: ... and biotinylated anti-STII (5A9F9, Genscript), followed by SAv-DyLight488 ...
-
bioRxiv - Bioengineering 2022Quote: ... The remaining parts were synthesized and cloned by Genscript Corp ...
-
bioRxiv - Cell Biology 2022Quote: ... The trapping mutants of TMX4 (TMX4C67A-V5) and TMX3 (TMX3C53A-V5) were synthesized by GenScript. The TMX3-V5 WT and TMX4-V5 WT were obtained from trapping mutants by site-directed mutagenesis.
-
bioRxiv - Biophysics 2022Quote: ... The non-phosphorylated CCR5 peptide (0P) was obtained from GenScript and contained a biotinylated N-terminus.
-
bioRxiv - Biophysics 2022Quote: ... Full-length arrestin21-418 (C150L, C242V, C251V, C269S) in vector pET-28a (+) was obtained from GenScript. The complete construct contained an N-terminal hexahistidine tag followed by a TEV cleavage site (ENLYFQG ...
-
bioRxiv - Biophysics 2022Quote: The receptor constructs including wild-type CCR5 and all phosphosite mutants were synthesized from GenScript and subcloned in pcDNA3.1(+ ...
-
bioRxiv - Biophysics 2022Quote: ... coli (GenScript). In each case ...
-
bioRxiv - Biophysics 2022Quote: ... Sirt2_50 (residues S50-Q389) and SerRS (residues M1-A514) were prepared by Genscript (Piscataway, NJ), cloned separately into a pET30a(+ ...
-
bioRxiv - Cancer Biology 2022Quote: ... the cfDNA was modified and amplified to prepare the multiplexed paired-end sequencing libraries with the dual index using GenTrack Library Preparation Kit (GenScript). The sequencing libraries were prepared by end-repair ...
-
bioRxiv - Cancer Biology 2022Quote: ... a hybrid probe library with 6394 probes was designed and synthesized by GenScript. Magnetic bead-based capturing ...
-
bioRxiv - Molecular Biology 2022Quote: ... 15 µL of washed Protein G MagBeads (GenScript; cat: L00274) were added to the DNA samples and incubated overnight at 4°C ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... were purchased from Santa Cruz Biotechnology (item sc-222407, sodium ursodeoxycholic acid, ≥98% purity) or synthesized by Genscript ((pyroE)WLGGRFamide ...
-
bioRxiv - Biochemistry 2022Quote: ... All primary antibodies were tailor-made by GenScript (New Jersey, USA) with sequences found in Supplementary Table 7.
-
bioRxiv - Biochemistry 2022Quote: ... The following phospho-specific antibodies were used: pS384-RPA70 (monoclonal, custom generated by Genscript), pS10-Histone H3 (Cell Signaling ...
-
bioRxiv - Biochemistry 2022Quote: Fluorogenic oligonucleotide substrate 5’6-FAM-dArUdAdA-6-TAMRA3’ was purchased from GenScript. Unless state otherwise ...
-
bioRxiv - Biochemistry 2022Quote: ... and goat anti-Sch9 (GenScript, 1:1’000). To assess the loading ...
-
bioRxiv - Biochemistry 2022Quote: ... The sfGFP gene was synthesized by GenScript (Pédelacq et al., 2006), Japan (Tokyo ...
-
bioRxiv - Biochemistry 2022Quote: A codon-optimized open reading frame for Human DSS1 (DSS1) was synthesized (GenScript Inc.) with a SUMO protease cleavable N-terminal MVKIH-Strep-6x-HIS-SUMO tag ...
-
bioRxiv - Biochemistry 2022Quote: ... The DNA encoding this fusion protein was commercially synthesized (GenScript Inc) and cloned into pET15b bacterial expression vector at Nco I/BamH I cloning sites ...