Labshake search
Citations for Takara Bio :
3901 - 3950 of 5037 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... These guides were individually cloned into pAAV-U6-sasgRNA-CMV-mCherry-WPREpA at the BstXI and XhoI restriction enzyme sites using the In-Fusion HD cloning kit (Clontech). rAAV vectors were generated using similar plasmids and cloning methods as was referenced in (Matharu et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... The titer of harvested lentivirus was established using the Lenti-X RT-qPCR Titration Kit (Takara Bio, Cat. no. 631235). A representative calibration plot and LV tittering of pAIO is added as Supplementary data S4.
-
bioRxiv - Molecular Biology 2022Quote: ... Probes for FLuc (500 bp) were generated using gel-purified PCR amplicons containing GFP sequence and a BcaBEST Labeling kit (Takara) and [α-32P]-dCTP (PerkinElmer) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Amplified mTurbo and FLAG-cyp40 fragments were introduced into XbaI site of pUASp-K10-attB vector using In-Fusion HD Cloning Kit (Takara). To generate UASp-mTurbo-FLAG-cyp40deltaTPR ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was then purified and resuspended with SMART-Seq v4 Ultra Low Input RNA Kit (Takara Bio Inc., Shiga, Japan) according to the manufacturer’s instructions for mRNA amplification using 5’ template switching polymerase chain reaction (PCR) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Detection relied on a 32P-labeled DNA probe specific for GFP sequence synthesized with a random priming labeling kit (Takara) followed by exposure to film and development as described (43).
-
bioRxiv - Microbiology 2022Quote: ... The resulting mutant BAC was electroporated into NEB 10-beta cells and purified using the Nucleobond BAC 100 kit (Takara).
-
bioRxiv - Molecular Biology 2022Quote: ... Libraries for RNA sequencing were prepared from 5 ng RNA/sample using the SMARTer Stranded Total RNA-Seq Kit v2 -Pico Input Mammalian (Takara) according to the manufacturer’s instructions using 12 PCR cycles for amplification ...
-
bioRxiv - Molecular Biology 2022Quote: ... The freshly extracted plasmids were transformed into yeast strain Y2H gold by using a yeast transformation kit (TaKaRa, Beijing, China) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... were subjected to RNA-seq library preparation using SMARTer Stranded Total RNA-Seq Kit – Pico Input Mammalian (Cat. No. 635005, TAKARA). All the libraries were analysed through a Bioanalyzer for quality control ...
-
bioRxiv - Physiology 2022Quote: ... cDNA was generated from 200ng of RNA using PrimeScript RT reagent Kit with gDNA Eraser (Takara Bio; Cat. No. RR047A) according to the manufacturer’s directions ...
-
bioRxiv - Microbiology 2022Quote: ... A CVB3 genome encoding a NanoLuc luciferase (NLuc) reporter was generated using the In-Fusion HD Cloning Kit (Takara, 638909). NanoLuc luciferase was cloned from the pLenti6.2-Nanoluc-ccdB ...
-
bioRxiv - Microbiology 2022Quote: ... was used as the template for real-time RT-PCR performed according to the manufacturer’s protocol using the One Step TB Green PrimeScript PLUS RT-PCR kit (Takara-Bio) and the following primers ...
-
bioRxiv - Microbiology 2022Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using QuantStudio Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... 1 ng of total RNA was pre-amplified with the SMARTer Ultra Low Input kit v4 (Clontech, Mountain View, CA) per manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2022Quote: ... as described previously.15 Alkaline phosphatase (ALP) staining was also performed for pluripotency characterization using TRACP & ALP double-stain Kit (Takara) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Transient transfection was performed with the use of HilyMax liposome transfection reagent (Dojindo Laboratories) or CalPhos Mammalian Transfection Kit (Clontech). Unless otherwise noted ...
-
bioRxiv - Plant Biology 2024Quote: ... complete sequences of the three genomic segments of AV2 were obtained by 5ʹ- and 3ʹ-RACE with the SMARTer RACE cDNA amplification kit (Clontech) using infected Nicotiana occidentalis leaf material (DSMZ ...
-
bioRxiv - Systems Biology 2024Quote: ... Strand specific RNA-seq libraries were then constructed using the SMARTer Stranded RNA-seq kit (634485; Clontech, Kusatsu, Shiga, Japan), according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 μg of total RNA was reverse transcribed into complementary DNA (cDNA) using PrimeScript™ RT Reagent Kit (Takara, RR047B). Amplification of cDNA product was performed using specific primers with the TB Green® Premix Ex Taq™ II (Takara ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA encoding ZP3 was restored from the mouse ovarian tissue by RT-PCR using PrimeScript RT Reagent Kit (Takara, RR037). Two PCR amplicons including the 5′ region of the TECTA-ZP and the transmembrane domain (TMD ...
-
bioRxiv - Cell Biology 2024Quote: RNA sequencing libraries of rRNA-depleted nuclear RNA or polyA RNA were prepared with SMARTer Stranded Total RNA-Seq Kit v2 (Takara) according to the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR product was run on a 1% agarose gel at 85 V for 35 min and gel extracted using the Nucleospin Gel Extraction Kit (Takara). We then used PCR with KOD Polymerase 2x Mastermix (Millipore Sigma ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was prepared and cDNA was synthesized with the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara) and ran the Agilent Tapestation to assess cDNA product ...
-
bioRxiv - Immunology 2023Quote: ... Each gene fragment was PCR-amplified and cloned into a pcDNA 3.1 vector by using the In-Fusion HD cloning kit (Takara Bio). Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... cDNA libraries were generated using SMARTer Human TCR a/b Profiling Kit v2 (Takara Bio USA, San Jose, California, USA). Briefly ...
-
bioRxiv - Plant Biology 2024Quote: ... and introduced into linearized (with KpnI) pCGEN (Motteram et al. 2011) using the In-Fusion HD Cloning Kit (Takara Bio). The resulting vectors ...
-
bioRxiv - Molecular Biology 2024Quote: ... the annealed oligos were ligated into the digested lentiCRISPRv2 backbone using the DNA ligation kit (Mighty Mix) (Takara, Cat# 6023). Afterward ...
-
bioRxiv - Microbiology 2024Quote: ... The RNA samples were then reverse transcribed employing a One-Step SYBR PrimerScript reverse transcription (RT)-PCR kit (TaKaRa, Japan). Nested PCR conditions were as follows ...
-
bioRxiv - Neuroscience 2024Quote: ... and then the tip of the recording electrode was broken into the nested PCR reagent system (Prime ScriptTm RT reagent Kit with QDNA Eraser, Cat: RR0471, Takara), and a cDNA synthesis kit was used to synthesize cDNA following the manufacturer’s protocol (PrimeScriptm II1st Strand cDNA Synthesis Kit) ...
-
bioRxiv - Microbiology 2024Quote: ... Total RNA was extracted using RNApure FFPE Kit (CWBIO, Jiangsu, China) and then treated with DNase I (TaKaRa, Kyoto, Japan) to remove DNA contaminants ...
-
bioRxiv - Immunology 2024Quote: RNA libraries of esophageal epithelial tissue biopsies and organoids were prepared using SMART-Seq HT Ultra Low Input RNA kit (Clontech) and NEBNext Ultra II RNA Library Prep Kit for Illumina ...
-
bioRxiv - Immunology 2024Quote: ... and quantified using bulk RNA-seq (Psomagen) after construction of Illumina sequencing libraries using the SMARTer Stranded Total RNA-Seq Kit v3 - Pico Input Mammalian (Takara). Noise from low-expression transcripts was filtered ...
-
bioRxiv - Immunology 2024Quote: ... we ran our linearized plasmid backbone and 83 bp PCR products on a 1% agarose gel and recovered each using the Gel and PCR Clean-up Kit (Takara) per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... All 3 fragments were then ligated into pUC18T-mini-Tn7T digested with EcoRI and XmaI using the infusion kit (Takara). The deletion of bspD was complemented by cloning of a 2160 bp long sequence encoding bspD and its upstream region including eipA and its 5’ non-coding region harboring the CtrA-controlled promoter (22 ...
-
bioRxiv - Cell Biology 2024Quote: ... the Sar1 genome template was first amplified from HeLa genomic DNA with following primers (CCGCTCTAGAACTAGTACCCAAATGAGCTCTGGC, CGGTATCGATAAGCTTGCATCAGTATTAAATACACATG) and cloned into pBSIISK(-) by In-Fusion HD cloning Kit (TAKARA). Next ...
-
bioRxiv - Neuroscience 2023Quote: RNAs were extracted from cultured cells and tissues using RNA extraction kit and reverse transcribed into cDNAs (both from TAKARA) according manufacturers’ instructions ...
-
bioRxiv - Cell Biology 2024Quote: A PCR product containing the Human ORF for DDX3X was obtained directly from RNA using the Primescript High Fidelity RT-PCR kit from Takara. The PCR primers introduced BamHI and NotI sites at the 5’ and 3’ ends respectively ...
-
bioRxiv - Cell Biology 2024Quote: ... Three nanograms of total RNA were used for amplification using the SMART-Seq V4 Ultra Low Input RNA kit (Clontech) according to the manufacturer’s recommendations (10 PCR cycles were performed) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Library construction started from 4.9ng of RNA per sample made using the SMARTer Stranded Total RNA-seq Kit v3-Pico Input Mammalian (Takara; 634486). The quality of libraries was checked with the with the High Sensitivity DNA Reagents Kit (Agilent ...
-
bioRxiv - Immunology 2024Quote: ... 1 ng RNA was used as input to generate cDNA with the SMART-Seq v4 Ultra Low Input RNA Kit (Takara), according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Digests were run on a 0.8% agarose-TAE gel and full-length plasmids were extracted with the Nucleospin PCR and Gel Cleanup Kit (Takara, 740609). A LR reaction was performed with 150 ng entry library and 150 ng pDEST_HC_Rec_Bxb_v2 ...
-
bioRxiv - Bioengineering 2024Quote: ... Appropriate colonies were grown and the recombinant bacmid DNA was extracted using the NucleoBond Xtra Midi plasmid purification kit (TAKARA). The fifth instar silkworm larvae ...
-
bioRxiv - Biochemistry 2024Quote: ... The RNA was quantified and 1.5 μg of RNA was used to prepare cDNA using PrimeScript 1st strand cDNA Synthesis Kit (Takara Bio) and random hexamer primer ...
-
bioRxiv - Cell Biology 2024Quote: ... One to six nanograms of RNA were used to generate a cDNA library using the SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Takara). Samples were sequenced with a NextSeq 500 (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcription reaction was set up using the cleaned-up RNA (1.6µg) using PrimeScript™ RT reagent Kit (Takara, Japan). The RT reaction was carried out with buffering temperature at 25 ºC for 2 mins ...
-
bioRxiv - Immunology 2022Quote: FACS sorted cells (5,000 cells) were subjected to cDNA synthesis using SMART-Seq v4 Ultra Low Input RNA Kit for sequencing (Takara/Clontech). Barcoded libraries were generated by the Nextera XT DNA Library Preparation kit (Illumina ...
-
bioRxiv - Immunology 2022Quote: FACS sorted cells (5,000 cells) were subjected to cDNA synthesis using SMART-Seq v4 Ultra Low Input RNA Kit for sequencing (Takara/Clontech). Barcoded libraries were generated by the Nextera XT DNA Library Preparation kit (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... n = 3 pools of 250 GFP+ cells were collected for direct RNA-Seq library preparation using the SMART-Seq HT PLUS kit (Takara), according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... lentiviral constructs pCMV-VSV-G and pCMV-dR8.2 dvpr 98 were transfected in HEK293T cells by the calcium-phosphate method (CalPhos Mammalian Transfection Kit, Takara, 631312) for virus production ...