Labshake search
Citations for Takara Bio :
2801 - 2850 of 5037 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... The resulting cDNA was subjected to relative quantitative PCR using a SYBR Premix Ex TaqTM kit (TaKaRa) on a Roche LightCycler 480 real-time PCR machine ...
-
bioRxiv - Plant Biology 2022Quote: ... One microgram DNAse-treated RNA was converted to cDNA using Prime RT-PCR kit (Takara Bio Inc.). The qRT-PCR was performed on 11 selected DEGs containing DRE elements ...
-
bioRxiv - Neuroscience 2022Quote: ... total RNA was reverse transcribed to cDNA using the PrimeScript™ RT reagent Kit (TaKaRa, RR037A, Japan). Convergent and divergent primers were used to detect the expression of linear and circular RNA transcripts ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA libraries were prepared using SMART-seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa Bio), which is based on the SMART-seq2 method (Picelli et al. ...
-
bioRxiv - Microbiology 2022Quote: ... the fragments were sequentially ligated into the target vector using the In-Fusion HD Cloning Kit (Clontech). The resulting plasmid sequences were verified by Sanger sequencing (GATC Biotech ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... single-stranded cDNA was generated from RNA using the SMARTer cDNA synthesis kit (Clontech, Palo Alto, CA) with tagged oligo-dT primers that include one of eight 15-bp barcodes to distinguish individual samples (2 species x 2 tissues x 2 biological replicates) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’ multiplexed RNA-sequencing was performed with the Takara SMART-Seq v4 3’ DE Kit (Takara 635040) followed by Nextera XT (Illumina FC-131-1024 ...
-
bioRxiv - Genomics 2022Quote: ... CH17-203N23 and CH17-449P15 BACs were extracted by using a NucleoBond Xtra BAC kit (Takara, 740436.25). ∼1 μg of BAC DNA was digested with 30 nM of sgRNAs (IDT) ...
-
bioRxiv - Cell Biology 2022Quote: The cDNA synthesis was done using SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Clontech) and the library was prepared using Nextera XT DNA Library Prep kit (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell pellets was collected and isolated for total RNA with MiniBEST Universal RNA Extraction Kit (Takara, #9767). Total RNA (1 μg ...
-
bioRxiv - Plant Biology 2021Quote: ... gDNA removal and first-strand cDNA synthesis were conducted by PrimeScriptTM RT reagent Kit (Takara, Beijing, China) with 0.5 μg total RNA for each sample ...
-
bioRxiv - Developmental Biology 2020Quote: ... cDNA libraries were prepared using the SMARTer Stranded Total RNA-Seq Kit v2-Pico Input (634412, Takara). A total of 32 samples were sequenced for 50-bp single-end reads across 4 lanes on an Illumina HiSeq 2500 by the University of Michigan Advanced Genomics Core ...
-
bioRxiv - Plant Biology 2021Quote: ... The cDNA used for RT-PCR was synthesized using the PrimeScrip First-Strand cDNA Synthesis Kit (TaKaRa). RT-PCR cycling conditions were as follows ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA synthesis was performed with the Clontech SMARTSeq v4 3’ DE kit (Takara Bio USA, Inc. 635040) kit ...
-
bioRxiv - Neuroscience 2020Quote: ... The knock-in plasmid was constructed by using In-Fusion HD Cloning kit (Takara Bio USA #639650) or NEBuilder HiFi DNA Assembly kit (New England Biolabs #M5520 ...
-
bioRxiv - Molecular Biology 2020Quote: The cDNA synthesis kits and SYBR Green Master Mix were obtained from Clontech (Mountain View, CA, USA). Dexamethasone and Granzyme B inhibitor Z-AAD-CMKwere purchased from Sigma-Aldrich (St ...
-
bioRxiv - Molecular Biology 2020Quote: DNA ligation was performed using standard ligation techniques (Takara DNA Ligation kit ver. 2.1; Takara, Otsu, Japan). For transformation ...
-
bioRxiv - Neuroscience 2020Quote: ... spectrophotometer followed by reverse transcription reaction to produce cDNA using PrimeScript RT Reagent Kit (Takara, Clonetech, Japan). Specific primers against the genes of interest (Table 3 ...
-
bioRxiv - Microbiology 2020Quote: ... Reverse transcription was performed with a PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Cat no. RR047A) and qRT-PCR was performed on StepOne Plus Real-time PCR system (Applied Biosystem ...
-
bioRxiv - Plant Biology 2021Quote: ... Reverse transcription of RNAs were carried out using PrimeScript II 1st strand cDNA Kit™ (Takara, Japan). The coding sequences of DGAT1s were amplified by a high-fidelity KOD-Plus-Neo polymerase (Toyobo ...
-
bioRxiv - Biochemistry 2021Quote: pRM823 (pUC118-bamA) was constructed by in vitro recombination using In-Fusion HD cloning kit (Takara Bio) of a EcoRI-BamHI fragment from pUC118 and a bamA fragment prepared by PCR amplification from the genome of MC4100 using a pair of primers ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was synthesized from equivalent total RNA using PrimeScript™ RT reagent Kit with gDNA Eraser (TAKARA) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA synthesis was performed using SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara #634894) according to the manufacturer’s instructions except that 10 µL instead of 9 µL was used to optimize for low RNA input ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was extracted from PSCs and vesicles by Mini BEST Universal RNA Extraction Kit (Takara, Japan), as previously described (66) ...
-
bioRxiv - Biochemistry 2020Quote: ... PCR fragments were sequenced and individual nanobodies were cloned using the In-Fusion cloning kit (Takara Bio) into a pET28a vector linearised by PCR with primers NbLib_pET28a_fwd (GGTGACCGTGAGCAGCCACCACCACCACCACCACTGAGATCCGGCTGCTAAC AAAGC ...
-
bioRxiv - Bioengineering 2021Quote: ... an endotoxin-free plasmid midiprep DNA purification took place using NucleoBond Xtra Midi EF kit (Takara Bio) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Each RNA sample was reverse transcribed to 50 μl cDNA with RT-PCR Prime Script Kit (Takara). The cDNA (5 μl ...
-
bioRxiv - Systems Biology 2022Quote: ... cDNA was generated using the SMART-Seq V4 Ultra Low RNA Kit (Takara Bio, Mountain View, CA). After 14 cycles of library amplification ...
-
bioRxiv - Immunology 2022Quote: ... RNA (1 ng) was amplified using SMARTer library Ultra Low cDNA v4 kit (Takara Bio, Mountainview, CA). Sequencing cDNA libraries were preparing using a NexteraXT DNA library prep kit (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: ... cDNA was generated from 1 ng of input RNA using the SMART-Seq HT Kit (Takara 634455) at half reaction volume followed by Nextera XT (Illumina FC-131-1024 ...
-
bioRxiv - Molecular Biology 2022Quote: Single cells were prepared using the STORM-seq protocol (referencing the SMART-Seq Stranded Kit – Takara Bio) on the SPT Labtech Mosquito (HV) ...
-
bioRxiv - Pathology 2020Quote: ... RBD-scFv was purified from the supernatant using Capturem™ His-Tagged Purification Miniprep Kit (Takara Bio). One prep of 800 μL supernatant through one column of the kit yielded 102 μg/mL of RBD-scFv measured by NanoDrop™ 2000/2000c Spectrophotometers (ThermoFisher) ...
-
bioRxiv - Cell Biology 2020Quote: ... This step was performed using commercially available In-Fusion HD Cloning Kit (Clontech, Mountain View, CA, USA). The produced plasmid expresses PRC1 tagged with tgRFPt and SspB at the C-terminus ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNA was synthesized from 500 ng total RNA using PrimeScript RT reagent Kit (Takara Bio., Shiga, JAPAN). The absence of genomic DNA contamination was confirmed by PCR using a control without reverse transcriptase ...
-
bioRxiv - Developmental Biology 2020Quote: Complementary DNAs were prepared by SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara 634888) using 150~800pg of total RNA ...
-
bioRxiv - Bioengineering 2020Quote: ... Plasmid assembling steps were performed with the In-Fusion HD Cloning Kit (Clontech, Mountain View, CA, USA). The gene cassettes used for the cell-surface expression of hemicellulases were previously optimized [43 ...
-
bioRxiv - Immunology 2020Quote: ... RNA-Seq libraries were generated using the SMART-Seq v4 Ultra Low Input RNA Kit (Clontech Laboratories) as per the manufacturer’s recommendations ...
-
bioRxiv - Genetics 2020Quote: ... according to the manufacturer’s instructions and cDNAs were prepared using PrimeScriptTM RT Master Mix kit (Takara, RR036A). Analysis of mRNA expression was performed with SYBR Green Master Mix (Life Technologies ...
-
bioRxiv - Physiology 2021Quote: 200 ng of mRNA were reverse-transcribed to cDNA using the PrimeScriptTM RT reagent kit (RR037A; Takara). Fluorescence-based quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Genetics 2020Quote: ... Purified RNAs were used to construct the library using SMARTer smRNA-Seq Kit for Illumina (Takara, 635029) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... RNA-Seq libraries were generated using the SMART-Seq v4 Ultra Low Input RNA Kit (Clontech Laboratories) according to the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total RNA was extracted from the powder using the NucleoSpin RNA Plant Kit (Takara; http://www.takara-bio.co.jp/), according to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2020Quote: ... first-strand cDNA was synthesized by using a PrimeScript RT reagent kit (Perfect Real Time) (TaKaRa Bio) with random hexamer primers and extracted RNA ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... SARS-COV-2 virus detection was performed using the One Step PrimeScript RT-PCR kit (TaKaRa, Japan) on the LightCycler 480 Real-Time PCR system (Roche ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... the promoter was inserted into pRS41H-lacZ plasmid using an In-Fusion kit (Takara Bio USA Inc.). The pRS41H-lacZ plasmid was constructed by inserting the lacZ fragment amplified from the pSH18-34 plasmid into the pRS41H plasmid (Estojak et al ...
-
bioRxiv - Neuroscience 2020Quote: RNA-seq libraries were prepared using SMARTer Stranded Total RNA-Seq Kit v2 – Pico Input Mammalian (Takara Bio USA ...
-
bioRxiv - Developmental Biology 2020Quote: ... The two DNA fragments were then ligated into one plasmid with the InFusion HD cloning kit (Takara).
-
bioRxiv - Microbiology 2021Quote: ... total cellular RNA was isolated using the NucleoSpin RNA extraction kit (Macherey-Nagel/Takara, San Jose, California). cDNA was generated from bulk RNA with the high-capacity cDNA reverse transcription kit (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2020Quote: ... Both chicken DLX1 and DLX1 Q50E proteins were purified using Capturem His-Tagged Purification Maxiprep Kit (Clontech), and verified by Western blot with primary antibodies against 6x His tag (Invitrogen ...
-
bioRxiv - Genomics 2021Quote: ... RNAs were reverse transcribed by using the PrimeScript RT reagent Kit with gDNA Eraser (TAKARA, Kyoto, Japan). Quantification of candidate genes was conducted in triplicate by using Bio-rad iQ SYBR Green Supermix (Bio-rad ...