Labshake search
Citations for Takara Bio :
2601 - 2650 of 5037 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... was reverse-transcribed using a PrimeScript II 1st strand cDNA Synthesis Kit (Takara Bio, Shiga, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... site-directed mutagenesis of gPLT2 was performed using the in-fusion HD cloning Kit (Takara Bio). The further reactions followed the in-fusion HD cloning Kit manual (Takara Bio) ...
-
bioRxiv - Pathology 2024Quote: ... following the manufacturer’s instructions and used for reverse transcription with the PrimeScriptTM RT reagent Kit (TaKaRa).The sequences of FaMyo5 motor domains were amplified from the cDNAs of all the F ...
-
bioRxiv - Genomics 2023Quote: ... Eluted DNA was prepared as sequencing libraries with the ThruPLEX-FD Prep Kit (Takara bio, # R400675). Libraries were sequenced with 150-BP PE on an Illumina HiSeq 2500 Sequencing platform at Novogene.
-
bioRxiv - Immunology 2024Quote: ... banked cell pellets were rapidly thawed and processed using the Nucleospin® Blood XL kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... libraries were prepared by the iGE3 Genomic Platform using the SMART-Seq v4 kit (Clontech, 634893) for the reverse transcription and cDNA amplification ...
-
bioRxiv - Cell Biology 2024Quote: ... coli total RNA using SMARTer smRNA-Seq Kit for Illumina (Cat# 635029, Takara Bio, Shiga, Japan). Libraries were quality-checked on the Fragment Analyzer (Agilent Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... RT-PCR was performed with the SYBR Premix Ex TaqTM kit (DRR041A, Takara Bio, Shiga, Japan) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2024Quote: 5’ RACE of lncRNA VILMIR was performed using the SMARTer RACE 5’/3’ Kit (Takara, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... samples were prepared according to the SMARTer Ultra Low RNA kit for Illumina Sequencing (Takara-Clontech) per manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... samples were prepared according to the SMARTer Ultra Low RNA kit for Illumina Sequencing (Takara-Clontech) per manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... The TCR sequences were then isolated using 5’RACE (SMARTer RACE cDNA Amplification Kit, Takara Bio), followed by PCR amplification with primers designed to be complementary to TRAC (GTTGCTCCAGGCAATGGCCCCATTGCTC ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Microbiology 2024Quote: ... Reverse transcription of RNA was performed using PrimeScriptTM reagent Kit (Perfect Real Time) (Takara Bio Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... Purified RNAs were then subjected to library generation using SMARTer Stranded Total RNA-Seq Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Samples were processed using the SMART-Seq v4 Ultra Low Input RNA Kit (Clontech Laboratories, Inc.). Briefly ...
-
bioRxiv - Immunology 2023Quote: ... The titer of viral particles was estimated using a Lenti-X p24 Rapid Titer Kit (Clontech) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... Strand-specific libraries were constructed using the SMARTer Stranded Total RNA-seq Kit (Takara catalog: 634862) following ribosomal RNA removal using RiboGone (Takara catalog ...
-
bioRxiv - Immunology 2023Quote: ... mRNA-seq library preparation was performed with SMART-Seq® v4 PLUS Kit (R4000752, Takara Bio). Single-end multiplexed libraries were sequenced using the NextSeq 2000 instrument (Illumina ...
-
bioRxiv - Plant Biology 2023Quote: ... First-strand cDNA was synthesized with a PrimeScript™ RT reagent kit with gDNA Eraser (Takara). For gene expression pattern analysis ...
-
bioRxiv - Plant Biology 2023Quote: ... and then cloned into pENTR/D/SD entry vector using the In-Fusion cloning kit (Takara). Inserts of all plasmids were sequenced by Macrogen ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μg total RNA was reverse transcribed into cDNA with the SMARTer RACE 5’ Kit (Clontech). PCR was performed using primer GSP-HO1 and the Universal Primer Mix (UPM ...
-
bioRxiv - Neuroscience 2023Quote: ... ds-cDNA was generated using the SMARTer Ultra Low RNA kit for Illumina Sequencing (Takara-Clontech) per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... libraries were prepared using SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Takara, 634411). Single-end sequencing was performed on the Ilumina NovaSeq platform with a sequencing depth of 80 million reads and a read length of 100 bp.
-
bioRxiv - Plant Biology 2024Quote: ... The first-strand cDNA synthesis was performed with the Prime Script RT Master Mix kit (Takara). Quantitative real-time PCR was performed at 60°C using Takyon No ROX SYBR 2X MasterMix blue dTTP (Eurogentec ...
-
bioRxiv - Molecular Biology 2024Quote: ... YCplac22 plasmids that carry tsa1 mutant alleles were constructed using the PrimeSTAR Mutagenesis Basal Kit (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The first step of cDNA synthesis was done using the SMARTer PCR cDNA Synthesis Kit (Takara). Then ...
-
bioRxiv - Immunology 2023Quote: ... cDNA libraries were prepared using SMART-seq® v4 Ultra Low Input RNA Kit (#634888, Takara). The NEB Ultra II FS DNA kit (#E7805S ...
-
bioRxiv - Neuroscience 2023Quote: ... Adeno-associated virus (AAV) cell-lysates were produced using the AAVpro Purification Kit (All Serotypes) (Takara) with slight modifications ...
-
bioRxiv - Cell Biology 2023Quote: ... Reverse transcription of RNA to cDNA was performed using the PrimeScript RT Reagent kit (RR037A, Takara). Quantitative RT-PCR was then performed on the cDNA using TB Green Premix Ex Taq II (RR820A ...
-
bioRxiv - Genomics 2023Quote: ... We extracted high-molecular-weight (HMW) DNA using Nucleobond® HMW DNA extraction kit (Takara Bio) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... ds-cDNA was generated using the SMARTer Ultra Low RNA kit for Illumina Sequencing (Takara-Clontech) per manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcription and amplification were performed using One Step PrimeScript™ RT-PCR Kit (Takara, Japan) and reaction performed and visualized using Stratagene Mx3000P qPCR System real-time PCR system (Agilent ...
-
bioRxiv - Developmental Biology 2023Quote: ... and reverse transcribed to synthesize cDNA using a PrimeScript RT Master Mix reverse transcription kit (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: ... we synthesized the first-strand cDNA using the PrimeScript 1st-strand cDNA synthesis kit (TaKaRa, Japan). The qRT-PCR was conducted in a 20μl reaction volume employing SYBER Green Master Mix (TaKaRa ...
-
bioRxiv - Plant Biology 2023Quote: ... Site-directed mutagenesis at the CESA1 sequence was performed using the infusion cloning kit from Takara Bio ...
-
bioRxiv - Plant Biology 2023Quote: Total RNA was extracted from Col-0 and mutant seedlings using an RNAiso Plus kit (Takara). Complementary DNAs (cDNA ...
-
bioRxiv - Microbiology 2023Quote: ... the amplified DNA fragments were self-ligated using the In-Fusion HD cloning kit (TAKARA, Japan) to generate pET15-SmaI.
-
bioRxiv - Immunology 2023Quote: ... and was cloned into pT2/HB vector through In-Fusion HD Cloning Plus kit (Takara Bio) following manufacturer’s instructions.
-
bioRxiv - Biochemistry 2023Quote: The plasmids for producing XccOpgD mutants were constructed using a PrimeSTAR mutagenesis basal kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... The rescued rAds were purified using Adeno-X Maxi Purification Kit (Cat. No: 631533, Takara, Japan).
-
bioRxiv - Cancer Biology 2022Quote: ... and converted into cDNA with the PrimeScriptTM RT reagent kit (Takara, Diatech Lab Line, Ancona, Italy). RT-qPCR was performed with 25 ng of the template cDNA using the qPCRBIO SyGreen 2X (PCR Biosystems ...
-
bioRxiv - Developmental Biology 2022Quote: After amplification of the cDNA library using the Smart-Seq v4 Ultra Low Input Kit (Clontech), the library was prepared using the NEBNext Ultra RNA library prep kit for Illumina (New England Biolabs) ...
-
bioRxiv - Cell Biology 2022Quote: Genomic DNA was extracted from HEK 293T cells using a NucleoSpin Blood kit (Takara Bio; 740951) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: CDNA synthesis was done using SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Clontech) and the library was prepared using Nextera XT DNA Library Prep kit (Illumina ...
-
bioRxiv - Genomics 2022Quote: ... Digested samples were column purified using the NucleoSpin Gel and PCR Clean-Up kit (TaKaRa 740609) according to the manufacturer’s directions ...
-
bioRxiv - Genetics 2022Quote: We prepared cDNA libraries with a SMART-seq v4 Ultra Low Input RNA Kit (Takara Bio) and SQK-LSK109 (Oxford Nanopore Technologies) ...
-
bioRxiv - Genetics 2022Quote: ... in a 10 µL reaction volume with the PrimeScript RT Reagent Kit with gDNA Eraser (Takara) following the recommended protocol ...
-
bioRxiv - Genetics 2022Quote: ... pre-capture amplification was performed using the Takara LA Taq HotStart kit (TaKaRa Bio USA, Inc.) in two ...
-
bioRxiv - Genetics 2022Quote: ... Reverse transcription for quantitative PCR (qPCR) analyses was performed with PrimeScript RT Master Mix kit (Takara). qPCR was performed with TransStart Top Green qPCR SuperMix kit (TransGen).