Labshake search
Citations for Takara Bio :
1951 - 2000 of 2318 citations for Dengue Virus Serotype 4 NS1 Protein Insect Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: The total RNA of the cell samples was extracted with 1000-800 µl RNAiso Plus reagent (Takara, Kyoto, Japan) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: About 130 ml of clarified cell suspension was combined with 3 mL of TALON® resin (Takara Bio 635503) previously equilibrated in lysis buffer and rocked at 4°C for 1 h ...
-
bioRxiv - Biochemistry 2022Quote: Expression inserts for cell lines were generated by PCR amplification and ligated into the pLVX-tight-Puro vector (Clontech) using the NEB HiFi DNA Assembly Kit (New England Biolabs ...
-
bioRxiv - Cell Biology 2022Quote: ... All lentiviral particles were produced in Lenti-X 293T cells using the Lenti-X HTS Packaging System (Takara, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: SH-SY5Y cells were seeded on the glass bottom plates and transfected with 0.5 μg of Mito dsRED plasmid (Clontech) using lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... The HSP4 amplicon was purified and 75ng incubated with 50ng of EcoRV digested puc19_RV vector for 15 minutes at 50°C and transformed into Stellar competent cells (TAKARA). Positive clones were verified by Sanger sequencing ...
-
bioRxiv - Neuroscience 2021Quote: ... Three technical replicates of 300 cells each were sorted from each individual mouse into 1.5mL microcentrifuge tubes containing cell lysis buffer buffer from the Clontech SMART-Seq HT (Takara) kit for direct cDNA synthesis and RNAseq library generation.
-
bioRxiv - Cancer Biology 2020Quote: LNCaP cells were seeded into 6-well plates and transfected at 70% confluency using Xfect Transfection Reagent (#631317, Clontech) with 5 µg of pEmCherry-C2 NTF2 (pDL23) ...
-
bioRxiv - Cell Biology 2019Quote: ... Infected cells were cultured on Geltrex in NPC medium with 1 × RevitaCell supplement and 2 ug/ml Doxycycline (Clontech) to induce NGN2 gene expression ...
-
bioRxiv - Pathology 2020Quote: ... A total of 1 × 106 cells were used for total RNA extraction using RNAiso Plus reagent (Cat.#9109, TaKaRa), followed by treatment with 10 U of recombinant DNase I (Cat.#2270A ...
-
bioRxiv - Systems Biology 2020Quote: ... scRNA-seq libraries of full length polyA-positive mRNA’s were generated for each cell using SMART-Seq v4 technology (Takara). For barcoding ...
-
bioRxiv - Cell Biology 2020Quote: ... GGTATCGATAAGCTTACCAGGTAATGCAAGTCCTCGCCG and pBS2_Pericentrin C-ter_InsR: CGCTCTAGAACTAGTAGAATGCTCCGGGTTCCACTGA) from the genomic DNA of HeLa cells and cloned into pBluescript using the Infusion Cloning kit (Takara). A BamHI sequence with a silent mutation to prevent re-cutting was generated in the middle of the homology arm domain by mutagenesis PCR (Pericentrin C-ter silent BamHI_F ...
-
bioRxiv - Cell Biology 2020Quote: ... 35 mm wells of MIN6 cells were co-transfected with 2.5 µg of pX330 containing gRNAs and 1 µg of pEGFP-C2 (Clontech). After 48 h ...
-
bioRxiv - Immunology 2021Quote: ... and transduced to NK-92MI cells in a 24-well plate coated with 0.5 µg/ml of RetroNectin diluted in PBS (Clontech). Two days later ...
-
bioRxiv - Developmental Biology 2019Quote: ... Stable transgenic cell lines were established according to the manual of the Tet-Express inducible expression systems (Clontech, 631169). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... Single cells were converted to cDNA and amplified using Smart-Seq V4 Ultra Low Input RNA Kit (Takara Bio). The cDNA output was then processed with Nextera XT DNA Library Preparation Kit ...
-
bioRxiv - Genomics 2021Quote: Total RNA extracted from cultured cells was used for reverse transcription using the PrimeScript RTase (Takara Bio, Shiga, Japan) with random hexamers ...
-
bioRxiv - Neuroscience 2021Quote: Reverse transcribed RNA from sorted cells was generated by SMART-Seq v4 Ultra Low Input RNA Kit (Takara Bio). Real-time PCR was performed using a Fast SYBR green PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Biochemistry 2021Quote: ... The resulting cell lysate was used for affinity purification and flowed over a TALON cobalt affinity resin (Takara Bio). The cobalt resin was washed with ~20 column volumes (CV ...
-
bioRxiv - Immunology 2021Quote: ... Antibodies were produced by transient transfection of human epithelium kidney 293T Lenti-X cells (Clontech Laboratories, Mountain View, CA) using the JetPrime transfection kit (Polyplus Transfection Illkirch ...
-
bioRxiv - Immunology 2020Quote: ... CR3022-CAR retrovirus was harvested after 48-72 hours and transduced to NK92MI cells in a 24-well plate coated with 0.5 μg/ml of RetroNectin diluted in PBS (Clontech). Two days later ...
-
bioRxiv - Immunology 2021Quote: ... Cells were harvested after 3 d and AAV6 was purified with a filtration-based kit (Takara AAVpro Purification Kit) per the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: Cell death was assessed by the release of LDH in conditioned medium using LDH Cytotoxicity Detection Kit (TaKaRa, CA). IL-1β levels in conditioned media were measured by ELISA (eBiosciences ...
-
bioRxiv - Immunology 2021Quote: ... 100,000 cells were sorted into 200 uL PBS with 1 uM DTT and 5 uL RNase Inhibitor Cocktail (Takara); for ex vivo culture experiments ...
-
bioRxiv - Cell Biology 2021Quote: ... US) and human cervical adenocarcinoma cells expressing a tetracycline-inducible repressor (HeLa Tet-Off, Clontech, Mountain View, California, US) were cultured in Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Cancer Biology 2020Quote: WM983B cells were seeded into 6-well plates and transfected at 70% confluency using Xfect Transfection Reagent (#631317, Clontech) with 5 µg of pTetOne NTF2 (pDL66 ...
-
bioRxiv - Cancer Biology 2022Quote: Snap-frozen cells were thawed on ice and RNA extracted with Takara’s Nucleospin RNA Plus kit (Takara Cat. # 740984.50) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... the recombinant pAAV-CRE plasmid was packaged in HEK293T cells using pHelper and pRC2-mi342 plasmids (Takara, Catalog #632608). Cells were harvested three days after transfection and AAV2 was isolated using AAVpro Extraction Solution (Takara ...
-
bioRxiv - Cell Biology 2022Quote: HeLa cells stably expressing GFP-SNX32 from an inducible promoter were established following the distributor protocol (Takara Bio Inc.). GFP-SNX32 full-length gene was cloned onto pLVX-TRE3G Vector ...
-
bioRxiv - Microbiology 2022Quote: ... single-cells were isolated using a BD FACS Aria III for sorting individual cells into 96-well plates prefilled with lysis buffer (0.26 μl of 10×Lysis buffer (Takara), 0.03 μl of RNase Inhibitor (100 U/μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... individual pTRIPZ-PTBP1 vectors were co-transfected with psPAX2 and pMD2.G into Lenti-X 293T cells (Takara, 632180), and the supernatant was collected twice at 48 h and 72 h post-transfection ...
-
bioRxiv - Neuroscience 2022Quote: ... and a subset (approximately 75,000 cells) was pelleted prior to RNA extraction using the NucleoSpin RNA Plus XS kit (Takara) following manufacturer protocol ...
-
bioRxiv - Genetics 2024Quote: ... cells were harvested and vectors were purified using the AAVpro purification kit (cat.: 6666; Takara Bio, Kusatsu, Shiga, Japan) as per manufacturer’s instructions and stored at -80 °C until further use ...
-
bioRxiv - Cancer Biology 2024Quote: ... Barcode sequence of each clone was PCR amplified directly from the cells using Terra PCR Direct Polymerase kit (Takara) for Sanger sequencing using previously described primers (5).
-
bioRxiv - Neuroscience 2024Quote: ... HEK293 cells were first incubated with ARIAD ligand at a concentration of 1 µM (AL; D/D Solubilizer; Takara) for the indicated times ...
-
bioRxiv - Microbiology 2024Quote: ... pseudotyped with LUJV GPC were produced by transfecting retroviral transfer vector pLXIN-Luc encoding luciferase as a reporter gene together with LUJV-flag or mutated LUJV-flag in pcDNA3.1 into the GP2-293 retroviral packaging cell line (Clontech). GP2-293 cells were seeded at 5×106 on 10-cm plates and transfected 24 h later with 5 µg of LUJV-flag/LUJV-flag-mut and 5 µg Luciferase using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Synthetic Biology 2023Quote: A 10 cm dish of HEK293T cells that had been transfected with the GFP expressing plasmid pEGFP-N1 (Clontech) was washed with PBS and lysed by sonication on ice in PBS supplemented with 0.2 % Triton X100 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was isolated from cells or tumors using a Mini BEST Universal RNA Extraction Kit (Takara, Shiga, Japan). cDNA was prepared from total RNA by reverse transcription using oligo-dT primers (Takara) ...
-
bioRxiv - Microbiology 2022Quote: ... 293T cells were co-transfected with the aforementioned lentiviral vector plasmid and Lentiviral High Titer Packaging Mix (Takara Bio).
-
bioRxiv - Bioengineering 2023Quote: ... was cloned into the prey vector pPR3-N and co-transformed into yeast strain NMY51 cells together with pDHBⅠ-GhERF105a plasmid according to the Matchmaker user’s manual protocol (Clontech). Yeast transformants were selected by growth on synthetic dropout nutrient medium SD/-Leu/-His/-Ade/-Trp (Clontech ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES pH 7.4 (Takara), 35 mM KGlu (Sigma) ...
-
bioRxiv - Genomics 2023Quote: ... The ligation reaction (1 µL) was transformed into 50 µL of Escherichia coli HST08 premium electro-cells (Takara, Japan) using a Gene Pulser Xcell (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... Individual lentiCRISPRv2 vectors were introduced along with packaging vectors into human embryonic kidney (HEK) 293T cells via calcium phosphate transfection according to the manufacturer’s protocol (Clontech). Lentivirus was harvested at 48 and 72 hours after transfection in RPMI media supplemented with 10% FBS and filtered with 45 μm filters prior to transduction of cancer cell lines using centrifugation at 1000 g for 2 hours in the presence of 8 μg/mL of polybrene (Santa Cruz Biotechnology) ...
-
bioRxiv - Microbiology 2023Quote: ... HEK-293/17 cell media were harvested and concentrated overnight with a Lenti-X concentrator (Clontech, Mountain View, CA) according to the manufacturer’s protocol and resuspended in 10-fold less media volume prior to concentration.
-
bioRxiv - Immunology 2023Quote: cDNA was amplified from the collected cells using the SMART-Seq v4 Ultra Low Input RNA Kit (Clontech-TakaraBio). 1ng of amplified cDNA was used to generate barcoded libraries with the Nextera XT DNA library preparation kit (Illumina) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES pH 7.4 (Takara), 35 mM KGlu (Sigma) ...
-
bioRxiv - Microbiology 2023Quote: ... to ligate the variant insert pool into BsmBI-digested pHW2000 plasmid and transformed Stellar™ Competent Cells (Takara, #636763) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: TUNEL assays were performed to detect apoptotic cell death using Clonetech ApoAlert DNA Fragmentation kit (Takara, Kusatsu, Shiga, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... GP2-293 cells were cultured in DMEM (FUJIFILM Wako Pure Chemical) supplemented with 10% tetracycline-free FBS (Takara Bio).
-
bioRxiv - Genomics 2023Quote: ... Genomic DNA of the cell pellets was extracted and purified using a Nucleospin Blood XL kit (Takara Bio, #740950.10). Guides were amplified and barcoded by PCR using NEB Next Ultra ii Q5 MM (M0544L ...