Labshake search
Citations for Takara Bio :
1751 - 1800 of 2318 citations for Dengue Virus Serotype 4 NS1 Protein Insect Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Antigen-dependent inducible T cell reporter system for PET imaging of breast cancer and glioblastomabioRxiv - Synthetic Biology 2022Quote: ... Pantropic VSV-G pseudotyped lentivirus was produced via transfection of Lenti-X 293T cells (Clontech #11131D) with a pHR’SIN:CSW transgene expression vector and the viral packaging plasmids pCMVdR8.91 and pMD2.G using Mirus Trans-IT Lenti (Mirus #MIR6606) ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were harvested and rAAV6 particles were purified using an AAVpro Purification Maxi kit (Takara, 6666) according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: Cells were incubated with Ribonuclease H RNaseH (60 U/μl) (Takara Bio Inc., Code No. 2150A) for 4 hours before immunocytochemistry assay.
-
bioRxiv - Cancer Biology 2022Quote: ... Recombinant AAV2 was packaged in HEK293T cells using pHelper and pRC2-mi342 plasmids (Takara, Catalog #632608). Three days after transfection ...
-
bioRxiv - Neuroscience 2019Quote: ... AAVs were collected from HEK293T cells and purified using AAVpro Purification Kit (Takara Bio, Shiga, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... The DIE cells were cultured in IMDM media supplemented with 10% Tet system approved FBS (Clontech), 5μg/ml Puromycin and 6μg/ml Blasticidin ...
-
bioRxiv - Molecular Biology 2021Quote: ... total RNAs from siRNA-treated cells were reverse transcribed by PrimeScript II reverse transcriptase (Takara Bio) with oligo-dT and random primers ...
-
bioRxiv - Cell Biology 2019Quote: Total RNA was extracted from cultured cells using Takara MiniBest Universal RNA Extraction Kit (Takara, 9767). cDNA was synthesized through RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... Supernatants from 293T cells were harvested after 48 hours and concentrated using LentiX concentrate (Takara Bio).
-
bioRxiv - Immunology 2019Quote: ... Lentiviruses were generated in HEK293T cells and were concentrated using Lenti-X Concentrator reagent (Takara Bio) before transduction of BeWo cells ...
-
bioRxiv - Cell Biology 2020Quote: ... gDNA of CFU colonies was extracted by suspending the cell in 1×PCR buffer (Takara, R050A) containing 0.2mg/ml proteinase K (Tiangen ...
-
bioRxiv - Cell Biology 2020Quote: PC4 cells (Gordon et al., 2017) were incubated with 0.5 µM D/D Solubilizer (Takara; 635054) in a time course-dependent manner ...
-
bioRxiv - Genomics 2019Quote: ... 3ul of each LR reaction was transformed into 50 ul of Stellar competent cells (Takara Bio) via heatshock ...
-
bioRxiv - Cancer Biology 2020Quote: Total RNA was extracted from cells using the NucleoSpin RNA XS kit (Clontech, Moutain View, CA). The Smarter Ultra low RNA input kit (Clontech ...
-
bioRxiv - Biochemistry 2022Quote: ... mCherry-H2B HeLa cell lines were cultured in DMEM (PAM Biotech) supplemented with 10% FBS (Clontech), 2 mM L-glutamine (PAN Biotech) ...
-
bioRxiv - Cell Biology 2022Quote: The genome-wide Vienna sgRNA library was was lentivirally packaged in semiconfluent Lenti-X cells (Takara) via PEI transfection ...
-
bioRxiv - Cell Biology 2022Quote: Genomic DNA was extracted from HEK 293T cells using a NucleoSpin Blood kit (Takara Bio; 740951) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2022Quote: ... 56 plasmids in 293FT HEK cells using the CalPhos™ Mammalian Transfection Kit (Takara bio, 631312). Following 2 μM tamoxifen treatment ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA of cells was extracted using RNAiso Plus reagent (Takara Bio Inc. Otsu, Shiga, Japan) and reverse transcribed using HiScript III RT SuperMix (Vazyme ...
-
bioRxiv - Microbiology 2024Quote: HEK293T cells were transfected with expression plasmids using the TransIT-293 transfection reagent (Takara, Shiga, Japan), following the manufacturer’s instructions.
-
bioRxiv - Immunology 2024Quote: ... Plasmid sequences confirmed by Sanger sequencing (Quintara Biosciences) were transformed into Stellar Competent Cells (Takara Bio) and purified using the NucleoBond Xtra Midi endotoxin-free midi-prep kit (Takara Bio) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Mycoplasma contamination in cell cultures was routinely tested using the PCR mycoplasma detection set (Takara Bio). At approximately 70% confluence ...
-
bioRxiv - Developmental Biology 2024Quote: ... Wells containing single viable cells were automatically selected using the ICELL8 cx CellSelect v2.5 Software (Takara) with the green and not red logic ...
-
bioRxiv - Immunology 2024Quote: ... banked cell pellets were rapidly thawed and processed using the Nucleospin® Blood XL kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Each cloning vector was transformed into Escherichia coli DH5α competent cells (Takara Bio, Kusatsu, Shiga, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA from cell culture or heart tissue was isolated using RNA iso (Takara Bio, Japan) per the manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: Total RNA from isogenic THP1 cells was extracted with the use of Trizol reagent (Takara, 9109), reverse-transcribed into cDNA with a PrimeScript RT Reagent Kit (Takara ...
-
bioRxiv - Neuroscience 2023Quote: ... U2OSQ94 cells were cultured in DMEM +Glutamax supplemented with 10% Tet system approved FBS (Takara, 631368) and 1% Penicillin/Streptomycin ...
-
bioRxiv - Molecular Biology 2022Quote: ... The whole cloning reaction was used to transform Stellar™ chemically competent cells (Clontech® Laboratories) using the heat shock method ...
-
bioRxiv - Bioengineering 2023Quote: ... Cell and tissue were stained with the following primary antibody: rabbit anti-ZsGreen (1:500; Takara), rabbit anti-NeuN (1:500 ...
-
bioRxiv - Molecular Biology 2023Quote: ... gRNA and targeting vectors were transfected into HAP1 cells (C859, Horizon) using Xfect Transfection Reagent (Takara). Integration of the hygromycin resistance marker in exon 4 was also confirmed by PCR with the following primers ATCTTTGTAGAAACCATCGGCGCAGCTATT (anneals to hygromycin resistance gene ...
-
bioRxiv - Cell Biology 2023Quote: ... Genomic DNA was isolated from frozen cells using the Nucleospin Blood XL kit (Takara Bio, #740950.10) and amplified with barcoded primers by index PCR (see table S10 for sequences) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentiviruses collected from the cell culture supernatants were concentrated using the Lenti-X-concentrator (Takara Bio).
-
bioRxiv - Cell Biology 2022Quote: MCF-7 and T47D cells were harvested and total RNA was extracted with RNA Trizol (TAKARA) following the manufacturer’s recommendations ...
-
bioRxiv - Systems Biology 2023Quote: ... Genomic DNA was extracted from cell pellets using the Machery Nagel NucleoSpin Blood Kit (Midi, Clontech Cat ...
-
bioRxiv - Genomics 2023Quote: ... Recombinant AAV2 was packaged in HEK293T cells using pHelper and pRC2-mi342 plasmids (Takara, Catalog #632608). Three days after transfection ...
-
bioRxiv - Plant Biology 2023Quote: ... cDNA was synthesized and amplified from cell lysates using a SMART-Seq HT Kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: We extracted total RNA from rat cells and tissues employing the TRIzol reagent (D9108A, TaKaRa Bio). The RNA was then reverse-transcribed into complementary DNA (cDNA ...
-
bioRxiv - Bioengineering 2023Quote: ... Plasmid DNA from the Gibson assembly reaction was then transformed into Stellar Competent Cells (Takara Bio).
-
bioRxiv - Biophysics 2023Quote: Human cell lines used in this study include U2OS and Lenti-X 293T (Takara Bio USA). Lenti-X 293T cells were only used for virus production ...
-
bioRxiv - Cancer Biology 2024Quote: ... and genomic DNA amplification was carried out using the PicoPLEX Single Cell WGA kit v3 (Takara) and following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Genomes in the cell lysate were digested by 600U/mL of HindIII (Takara Bio, Shiga, Japan) for 4 hours at 37°C ...
-
bioRxiv - Microbiology 2024Quote: The plasmids were transfected into 293Lac cells using TransIT®-293 Transfection Reagent (Takara, Shiga, Japan). After 3 days ...
-
bioRxiv - Genetics 2024Quote: ... The cells were then harvested and genomic DNA was extracted using NucleoSpin Blood XL kit (Clontech). Libraries were prepared and sequenced as previously described 4.
-
bioRxiv - Cancer Biology 2024Quote: ... it was concentrated 100-fold from cell culture medium using Lenti-X™ Concentrator (Takara, #631231) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA was isolated from cells using the NucleoSpin RNA Plus kit of Clontech Laboratories (Takara Bio Company). cDNA was constructed using the In-Fusion SMARTer Directional cDNA Library Construction kit of Takara Bio ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was extracted from cells and quantified using RNA Isolation Reagent kit (9109, Takara, Tokyo, Japan). cDNA was obtained from 1 µg of total RNA from each sample (Super M-MLV reverse transcriptase ...
-
bioRxiv - Neuroscience 2021Quote: ... we used In-Fusion HD enzyme premix and for bacterial transformation Stellar Chemically competent cells (Clontech, USA). The mutagenic libraries were produced in the 96-well plate with 46 bacterial colonies selected for each (two libraries per 96-well plate ...
-
bioRxiv - Molecular Biology 2021Quote: ... total RNA was extracted from HCT-116 cells by using an RNAiso plus reagent (Takara Bio, Japan) and was subsequently subjected to reverse transcription followed by PCR using a OneStep RT-PCR Kit (QIAGEN ...
-
bioRxiv - Cancer Biology 2019Quote: ... at a ratio of 2.5:1.0:0.6:0.5 to Lenti-X 293T cells (Takara, 632180, Kusatsu, Japan). A transfection reagent ...