Labshake search
Citations for Takara Bio :
1201 - 1250 of 2365 citations for 6 Chloro 4 hydroxy 2 methyl 2H thieno 2 3 e 1 2 thiazine 3 carboxylic acid methyl ester 1 1 dioxide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... 3 μl of each dilution was then spotted on a SD-Leu-Trp plate (ST0048, Takara Bio, USA) as a growth control ...
-
bioRxiv - Cancer Biology 2020Quote: ... After incubation membrane was washed with 1X TBST buffer 3 times and detected with ECL reagent (TAKARA, Japan) using Versa Doc (BD Bioscience ...
-
bioRxiv - Molecular Biology 2022Quote: ... A 25 nt poly(A) sequence was inserted after the 3’ UTR using the In-Fusion (Takara Bio) method.
-
bioRxiv - Cell Biology 2022Quote: ... Flt3 ligand (50 ng/ml) and IL-3 (20 ng/ml) onto plates coated with retronectin (Takara Bio).
-
bioRxiv - Developmental Biology 2022Quote: Rapid amplification of cDNA end (RACE) was performed using the SMARTer® RACE 5’/3’ Kit (Takara, #634858). 1ug of freshly isolated RNA from E8.5 embryo hearts was used to generate first strand cDNA according to the manufactural protocol ...
-
bioRxiv - Genetics 2022Quote: ... Total protein was harvested after 3 days of culture and analyzed by Western blot (mouse anti-DsRed, Clontech; rabbit anti-POU6F2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and in-chip reverse transcription PCR were performed using a 3’ DE Chip and Reagent kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... the single-stranded DNA (5’-AATTCAAAGAATTAACCTTAATTGAA GGGGAGGGTTCAGTACTTTTGTGTAGTACAAATATCAGTACTTTTGTGTAGTACAAAA GGGAGGGCTTCAATTAAGGTTAATTCTTTG-3’) was treated with T4 DNA ligase (Takara, Beijing, China) after annealing ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 5’ and 3’ ends of the cDNA were amplified using the SMARTer RACE cDNA Amplification Kit (Clontech) according to the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2023Quote: ... 5’RACE was performed with SMARTer RACE 5’/3’ Kit (Takara Bio USA, Inc. San Jose, CA USA) according to the manufacturer’s directions.
-
bioRxiv - Bioengineering 2024Quote: ... CD11b-specific amplicons were generated via 3-step nested PCR using PrimeSTAR GXL (Takara Bio, Kusatsu, Shiga, Japan) according to the manufacturer’s protocol with a 60°C annealing temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... Retroviral transduction was achieved by spinoculation of 3 × 106 mouse T cells on retronectin-coated plates (Takara Bio) with neat retroviral supernatant harvested from 293T packaging cells (2000xg ...
-
bioRxiv - Plant Biology 2024Quote: ... and inserted into BamHI-digested pGEX-4T-3 by using In-Fusion Smart Assembly Cloning Kit (Takarabio-Clontech). Full-length OcKSL4 cDNA was amplified by RT-PCR using primers 5’-GGATCCATGGCGAATTATCCCATGGAG-3’ (forward ...
-
bioRxiv - Cell Biology 2023Quote: The full-length cDNA expression library was constructed using the SMARTer RACE 5’/3’ Kit (Takara Bio, 634858) according to the manufacturer’s instructions for the In-Fusion SMARTer Directional cDNA Library Construction Kit (Takara Bio ...
-
bioRxiv - Microbiology 2021Quote: ... Clarified lysates were loaded onto a 1 mL TALON (Takara) column ...
-
bioRxiv - Genetics 2021Quote: ... and a 1:5000 dilution of anti-GFP (Takara, 632381). Blots were washed (3 × 10 mins ...
-
bioRxiv - Neuroscience 2021Quote: ... or 1× Nested Universal Primer (secondary PCR, Clontech Laboratories, Inc.) and gene-specific primers ...
-
bioRxiv - Developmental Biology 2021Quote: ... rabbit polyclonal anti-Tomato (Clontech Cat. #: 632496, dilution 1:400) and chicken polyclonal anti-GFP (Abcam Cat ...
-
bioRxiv - Developmental Biology 2020Quote: ... anti-DsRed (1/1,000, rabbit, Clontech Laboratories, Inc., Cat# 632496), and anti-cleaved caspase3 (1/500 ...
-
bioRxiv - Neuroscience 2021Quote: ... and rabbit anti-DsRed (Clontech, Cat. No. 632496, 1:500). All secondary antibodies were purchased from Jackson ImmunoResearch and used at 1:400 dilution ...
-
bioRxiv - Neuroscience 2021Quote: ... and rabbit anti-DsRed (1:500, Takara Bio Cat# 632475) with secondary antibodies goat anti-chicken 488 (1:1000 ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies used were mouse anti-STEM121 (1:500; Takara), chicken anti-GFAP (1:2,000 ...
-
Fascin regulates protrusions and delamination to mediate invasive, collective cell migration in vivobioRxiv - Cell Biology 2019Quote: ... and rabbit anti-dsRed 1:300 (Clontech, Mountain View, CA). After 6 washes in Triton antibody wash (10 minutes each) ...
-
bioRxiv - Systems Biology 2020Quote: ... 1 μL PrimeSTAR GXL Polymerase (R050B, Takara Bio, Kusatsu, Japan), 1 μL dNTPs ...
-
bioRxiv - Microbiology 2019Quote: ... cells were treated with 1 µg/mL of doxycycline (Clontech) for 3–5 days.
-
bioRxiv - Neuroscience 2019Quote: ... anti-dsRed (1:1000, Living Colors DsRed Polyclonal Antibody, Takara). After rinsing 5x 10 min each in PBST ...
-
bioRxiv - Neuroscience 2019Quote: ... Primary antibodies used were: rat monoclonal mCherry (1:2000, Clontech); mouse monoclonal tyrosine hydroxylase (TH ...
-
bioRxiv - Neuroscience 2020Quote: ... 1.67 U μl−1 Recombinant RNase Inhibitor (Takara Bio, 2313B), 1.67× First-Strand Buffer (Takara Bio ...
-
bioRxiv - Neuroscience 2020Quote: ... STEM121 (human cytoplasm, 1:2000; Y40410, Takara, Mountain View, CA), overnight at room temperature to detect engrafted cells ...
-
bioRxiv - Neuroscience 2021Quote: ... spiked with 0.2 U μl−1 RNase inhibitor (Takara, 2313A) and EDTA-free Protease Inhibitor Cocktail (Roche ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1 U/μl recombinant RNase inhibitor (Takara Cat.no. 2313A), pH ∼7.25 was prepared ...
-
bioRxiv - Neuroscience 2020Quote: ... spiked with 0.2 U μl−1 RNase inhibitor (Takara, 2313A) and EDTA-free Protease Inhibitor Cocktail (Roche ...
-
bioRxiv - Cancer Biology 2021Quote: ... a WST-1 cell proliferation assay kit (MK400, Takara Bio) was used according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-GFP (Clontech, JL-8, 1:5000 for western), rabbit anti-GFP (Chromotek ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse GFP antibody (Clontech, clone JL8, used at 1:4,000) was obtained from Takara (Saint-Germain-en-Laye ...
-
bioRxiv - Biochemistry 2022Quote: ... the supernatant was nutated with 1 mL TALON resin (Takara) for 30 min at 4 °C ...
-
bioRxiv - Neuroscience 2022Quote: ... a mouse anti-mCherry primary antibody (Takara Bio, 1:5000) was used instead of the substance P primary antibody to visualize hM3Dq-mCherry or mCherry-expressing cells.
-
bioRxiv - Cancer Biology 2020Quote: ... WST-1 assays were performed as per manufacturer’s instructions (Takara) (18).
-
bioRxiv - Neuroscience 2020Quote: ... and polyclonal rabbit anti-dsRed (632496, Clontech, dilution 1:500). Fluorescent images were acquired with a Zeiss 800 Airyscan using a 10x 0.45NA Plan-APOCHROMAT (Zeiss ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse anti-mCherry (1:200, Takara Bio/Clontech Laboratories, 632543), rat anti-BrdU (1:250 ...
-
bioRxiv - Neuroscience 2019Quote: ... and 1 U/μl recombinant RNase inhibitor (Takara Cat.no. 2313A), pH ∼7.25 ...
-
bioRxiv - Cell Biology 2020Quote: Mouse GFP antibody (Clontech, clone JL8, used at 1:4,000) was obtained from Takara (Saint-Germain-en-Laye ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-GFP (Clontech, JL-8, 1:5000 for western), mouse anti-Dhc (Developmental Studies Hybridoma Bank ...
-
bioRxiv - Developmental Biology 2021Quote: ... rabbit α-DsRed (1:400, Living colors, 632496 Takara Bio), rabbit α-Phospho-p44/42 MAPK (1:250 ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-dsRed (TaKaRa Bio, cat. no. 632496, 1:250), chicken anti-GFP (Aves ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse anti-mCherry (1:200, Takara Bio/Clontech Laboratories, 632543), rat anti-BrdU (1:250 ...
-
bioRxiv - Immunology 2022Quote: ... expression was induced by adding 1 μg/ml anhydrotetracycline (Takara) overnight in cell culture media ...
-
bioRxiv - Neuroscience 2023Quote: ... Green Fluorescent Protein (GFP) antibody (JL-8, 1:500, Clontech), Red Fluorescent Protein Antibody (DsRed ...
-
bioRxiv - Microbiology 2023Quote: ... 5 U μL-1 Taq DNA polymerase (Takara, CA, USA), 1x of PCR buffer (10x ...
-
bioRxiv - Neuroscience 2023Quote: ... except rabbit anti-dsRed (1:500, Cat# 632496, Takara Bio) was added to the primary antibody solution and AF568-conjugated goat-anti-rabbit (1:500 ...