Labshake search
Citations for Takara Bio :
1051 - 1100 of 2511 citations for 6 Chloro 4 hydroxy 2 methyl 2H thieno 2 3 e 1 2 thiazine 3 carboxylic acid methyl ester 1 1 dioxide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2019Quote: KOD-Plus-Ver.2 DNA polymerase (Toyobo, Osaka, Japan) was used to amplify ldsDNAs (PCR amplicons) using the pEGFP-C1 (Clontech, Mountain View, CA, USA) plasmid as the template ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2022Quote: ... while pGADT7-CmVPS41s and pGADT7-T control prey plasmids were transformed into yeast strain Y187 following the Yeastmaker Yeast Transformation System 2 instructions (Clontech by Takara Bio, Mountain View, USA). The transformed cells were grown either in SD-Trp agar plates for Y2HGold or in SD-Leu agar plates for Y187 at 30 ºC for 3-5 days ...
-
bioRxiv - Bioengineering 2024Quote: ... To synthesize cDNA, total RNA (8 µL, ca. 500 ng) was mixed with 2 µL of PrimeScript™ RT Master Mix (Takara Bio, Kusatsu, Japan) and incubated at 37°C for 15 min ...
-
bioRxiv - Biophysics 2019Quote: ... pEGFP-Actin (6116-1) was purchased from Clontech Laboratories.
-
bioRxiv - Genetics 2021Quote: 1:500 mouse anti-GFP (Takara, JL-8)
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-DsRed 1:1000 (Takara, cat# 632496). Samples were washed three times for 5 min in PBT and incubated in Alexa Fluor 488 or 594 secondary antibodies 1:500 (Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: ... anti-glucagon (Guinea pig 1:2500; TAKARA M182), anti-GFP (Chicken 1:1000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Living Colors anti-DsRed (Clontech #632496, 1:100), anti-RFP (Novus Biologicals #42649) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and Rabbit anti-DsRed (1:200, Takara 632496), Donkey anti-Chicken-Cy2 (1:200 ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-dsRed (1:1000, Cat. # 632496, Takara Bio Europe SAS ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary rabbit anti-RFP (Clontech 632496, 1:1000) and secondary goat anti-rabbit Cy3 (Jackson 111-165-144 ...
-
bioRxiv - Immunology 2019Quote: ... rabbit anti-DsRed polyclonal antibody (1:500; Clontech), Alexa Fluor 488-conjugated anti-chicken IgG antibody (1:500 ...
-
bioRxiv - Plant Biology 2020Quote: ... and anti-GFP (Takara Bio, 1:5,000 dilution) antibodies with incubation for 1 h and 16 h ...
-
bioRxiv - Genomics 2019Quote: ... 1) We added RNase Inhibitor (Clontech/TaKaRa, #2313B) to all wash buffers in place of DEPC and SUPERaseIn RNase Inhibitor (Ambion) ...
-
bioRxiv - Genomics 2019Quote: ... 1) We added RNase Inhibitor (Clontech/TaKaRa, #2313B) to all wash buffers in place of DEPC and SUPERaseIn RNase Inhibitor (Ambion) ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-DsRed (rabbit, Clontech, sc-390909, 1:500) in blocking solution overnight ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-DsRed (rabbit, Clontech, sc-390909, 1:500), anti-SYNORF1 (Synapsin ...
-
bioRxiv - Neuroscience 2021Quote: ... and rabbit anti-DsRed (1:2,000, Clontech, #632496). Secondary antibodies used were goat anti-Mouse Alexa 488 (1:200 ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-GFP monoclonal JL8 (1:3000, Clontech), and mouse anti-α-tubulin monoclonal DM1A (1:3000 ...
-
bioRxiv - Neuroscience 2020Quote: ... containing 1% protease inhibitor (Clontech, Mountain View, CA) and 1% phosphatase inhibitors (Millipore Sigma) ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-DsRed (1:1000, Clontech, No. 632496), rat anti-ELAV (1:30 ...
-
bioRxiv - Microbiology 2021Quote: ... or 100 ng mL-1 anhydrotetracycline (aTc) (Takara), as necessary.
-
bioRxiv - Neuroscience 2020Quote: Rabbit anti-DsRed (323496, Clontech 1:1000 dilution)
-
bioRxiv - Cell Biology 2021Quote: ... or pEGFP-N3 (Clontech, catalogue no. 6080-1) at 2.5 μg of DNA/60-mm well using Xtremegene9 (Roche Diagnostics ...
-
bioRxiv - Neuroscience 2022Quote: ... and mouse anti-mCherry antibodies (Clontech; 1:2000) in PBST-azide with 3% NDS ...
-
bioRxiv - Cell Biology 2022Quote: Plasmid DNA (pEGFP-N1, 5kb (Clontech, 6085-1) encoding a cytomegalovirus (CMV ...
-
bioRxiv - Cell Biology 2022Quote: ... OCN (1:200, Takara Bio Inc, Shiga, Japan) overnight at 4°C followed by corresponding fluorescence-linked secondary antibodies (Jackson ImmunoResearch Laboratories ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-DsRed (1:1000, Clontech, Mountain View, USA) and anti-Olig2 (1:200 ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-DsRed antibodies (1:3000, Takara, 632496). Sections were washed three times in PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies used: DsRed (Rabbit, 1:2000, Clontech), VGLUT1 (Guinea Pig ...
-
bioRxiv - Immunology 2022Quote: ... rabbit anti-DsRed polyclonal antibody (1:500; Clontech), rabbit anti-Lcp1 (1:1000) ...
-
bioRxiv - Developmental Biology 2019Quote: ... mCherry (Takara Bio or Novus Biologicals, 1:100). For Snail/Dach double immunostaining ...
-
bioRxiv - Neuroscience 2019Quote: ... containing 1% protease inhibitor (Clontech, Mountain View, CA) and 1% phosphatase inhibitors (Millipore Sigma) ...
-
bioRxiv - Neuroscience 2019Quote: ... Rabbit anti-DsRed (Clontech, 632496, 1:500 dilution), rat anti-DN-cadherin (Developmental Studies Hybridoma Bank ...
-
bioRxiv - Cell Biology 2020Quote: ... and doxycycline (1 μg/ml, 631311; Clontech Laboratories) were used for drug treatments.
-
bioRxiv - Neuroscience 2020Quote: ... and 1:500 rabbit anti-DsRed (632496, Clontech). The following secondary antibodies were used ...
-
bioRxiv - Developmental Biology 2020Quote: ... rabbit anti-DsRed polyclonal antibody (1:500; Clontech), Alexa Fluor 488-conjugated anti-chicken IgG antibody (1:500 ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-DsRED at 1:200 (Takara Bio), goat anti-mouse Cy3 at 1:200 (Jackson Labs) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and anti-Rabbit-DsRed (Clontech #632496, 1:500). Brains were rinsed twice with 0.1% PBST ...
-
bioRxiv - Microbiology 2019Quote: ... the WST-1 Cell Proliferation Assay System (TaKaRa) was used following the manufacturer’s recommendation ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-DsRed (1:1000, rabbit polyclonal, Takara, 632496), anti-TPH2 (1:1000 ...
-
bioRxiv - Microbiology 2020Quote: ... 1 mM bovine serum albumin (Takara, Kusatsu, Japan) and 12.6 μl Milli-Q water ...
-
bioRxiv - Developmental Biology 2021Quote: ... to detect mOrange (rabbit, Clontech 632496, 1:100). The polyclonal NvINSM1 antibody was raised by GenScript in rabbit against amino acids 3 – 170 of NvINSM1 expressed in and purified from E.coli ...
-
bioRxiv - Biochemistry 2021Quote: ... Anti-GFP (1:4,000, Living Colors, 632380, Clontech) was used to probe for GFP-CNAβ1 ...
-
bioRxiv - Biochemistry 2021Quote: ... mouse GFP (1:4,000, Living Colors, 632380, Clontech) and rabbit β-Actin (1:3,000 ...
-
bioRxiv - Neuroscience 2021Quote: ... hNSC antibody (SC121, 1:100; Takara: Cat #: Y40410) and vGlut 1 (vesicular glutamate transporter 1 ...
-
bioRxiv - Neuroscience 2021Quote: ... and mouse anti-mCherry antibodies (Clontech; 1:2000) in PBST-azide with 3% normal donkey serum ...
-
bioRxiv - Developmental Biology 2021Quote: ... and mouse anti-GFP (1:200; PA; Clontech). Alexa Fluor 488- ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse Anti-GFP (1:1000; JL-8, Clontech). Blots were washed three times with PBST and probed with secondary antibodies diluted in PBS with 1% milk and 1% BSA for one hour at 4°C ...