Labshake search
Citations for Takara Bio :
1301 - 1350 of 2365 citations for 6 Chloro 4 hydroxy 2 methyl 2H thieno 2 3 e 1 2 thiazine 3 carboxylic acid methyl ester 1 1 dioxide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Stem123 (AB-123-U-050, 1:1000 dilution; Takara Bio Inc.), TBR1 (ab183032 ...
-
bioRxiv - Neuroscience 2021Quote: ... Stem121 (AB-121-U-050, 1:1000 dilution; Takara Bio Inc.), Stem123 (AB-123-U-050 ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-DsRed (rabbit polyclonal, 1:500, Clontech, Cat# 632496, RRID: AB_10013483); anti-EGFR (goat polyclonal,1:100 ...
-
bioRxiv - Neuroscience 2021Quote: ... and mCherry (1:200, Takara Bio USA Inc./Clontech Laboratories, 632543). Retinae were then washed in 0.1% PBST for 3 × 10 minutes at room temperature and incubated with goat-anti mouse Cy3 (1:250 ...
-
bioRxiv - Neuroscience 2020Quote: ... and rabbit polyclonal anti-Ds-red (1:200; Clontech, Cat#632496). Secondary antibodies included Cy2 goat anti-mouse (1:400 ...
-
bioRxiv - Plant Biology 2021Quote: ... membranes were incubated in anti-GFP (Takara Bio, 1:5000 dilution) antibodies followed by a 2 h incubation in secondary goat anti-mouse-HRP (1:10,000 dilution ...
-
bioRxiv - Plant Biology 2021Quote: ... immunoblot with an anti-GFP antibody (1:5000 dilution, Takara Bio) followed by and detection were performed as described (Basu ...
-
bioRxiv - Neuroscience 2022Quote: ... and incubated with primary antibodies: mouse anti-GFP (1:2000; Clontech), mouse anti-FLAG (1:1000 ...
-
bioRxiv - Neuroscience 2019Quote: ... and rabbit αdsRed (1:500, #632496, ClonTech, Mountain View, CA, USA) in blocking solution ...
-
bioRxiv - Developmental Biology 2019Quote: ... rabbit anti-RFP (1:200, 632496, Clontech, Mountain View, CA, USA), mouse anti-β-galactosidase (1:1000 ...
-
bioRxiv - Neuroscience 2019Quote: ... rabbit anti-DsRed (1:200; 632496, Clontech, Mountain View, CA, USA), mouse anti-rat CD2 (1:200 ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 ug total RNA and PrimeScript RT Master Mix (Takara, Japan) was used for reverse transcription in a SimpliAmp Thermal Cycler (Life technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-dsRed (TaKaRa Bio, cat. no. 632496, 1:250 (57), chicken anti-GFP (Aves ...
-
bioRxiv - Plant Biology 2020Quote: pAS6 (Figure 1) carries the YFP coding region of pEYFP (Clontech) interrupted with the synthetic ...
-
bioRxiv - Genetics 2021Quote: ... washed and immunostained with rabbit Anti-dsRed (632496, Clontech; 1:1000) and/or mouse Anti-EGFP (DHSB 12A6 ...
-
bioRxiv - Cell Biology 2019Quote: The following plasmids were obtained commercially: pEGFP-C2 (Clontech #6083-1), pcDNA-EGFP-ELYS-polyA (Addgene #59746 ...
-
bioRxiv - Pathology 2021Quote: ... then loaded onto hand-packed 1 ml TALON (635507, Takara Bio) columns recirculating overnight at 1.5 ml/min ...
-
bioRxiv - Neuroscience 2019Quote: ... and rabbit anti-DsRed (1:1000, Takara Bio, Mountainview, CA, USA) primary antibodies was performed in blocking solution overnight at 4°C ...
-
bioRxiv - Genetics 2021Quote: ... probed with anti-GFP (Takara Bio Clontech, #632380, mouse, 1:5000) and anti-Tubulin (Sigma ...
-
bioRxiv - Genetics 2021Quote: ... probed with anti-GFP (Takara Bio Clontech, #632380, mouse, 1:5000) and anti-Tubulin (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... Primary anti-6xHis monoclonal mouse antibody (Clontech, 631212, diluted 1:1,000) was used to detect 6xHis-ubiquitin in samples permeabilized with 0.5% Triton-X100 ...
-
bioRxiv - Microbiology 2021Quote: ... HIV-1 viral stocks were titered by RT-qPCR (Takara #631235) to determine viral RNA copies / mL ...
-
bioRxiv - Cell Biology 2021Quote: ... Living Colors Polyclonal anti-Pan-RCFP (rabbit, 1:500, Clontech 632475), anti-GFP (chicken ...
-
bioRxiv - Cell Biology 2021Quote: ... Living Colors Polyclonal anti-mCherry/dsRed (rabbit, 1:500, Clontech 632496), Living Colors Polyclonal anti-Pan-RCFP (rabbit ...
-
bioRxiv - Genomics 2019Quote: ... 1-mM SMARTer Kit dNTP Mix (10 mM each; Clontech, 634936), 1.2-μM SMARTer Kit SMARTer II A Oligonucleotide (12 μM ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-dsRed (Living Colors DsRed Polyclonal Antibody, 1:250, Clontech). Secondary antibodies were Alexa 488 ...
-
bioRxiv - Developmental Biology 2022Quote: ... the following antibodies were used: Rx (rabbit; TaKaRa, #M228; 1:1,000), Nkx2.1 (rabbit ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-dsRed: (1:5000, Takara Bio, Clontech, Australia, Cat#: 632496), goat anti-mCherry (1:5000 ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-dsRed: (1:5000, Takara Bio, Clontech, Australia, Cat#: 632496), goat anti-mCherry (1:5000 ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies used were rabbit anti-DsRed (1:500; #632496, Takara), rat anti-mCherry (1:1000 ...
-
bioRxiv - Systems Biology 2022Quote: ... rabbit dsRed (1:500, Clonetech Takara 632496 to detect Tomato protein); mouse βTubulin (1:600 ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-mCherry monoclonal antibody (1:500; Takara Bio Cat# 632543), Alexa Fluor 488-conjugated anti-chicken IgG antibody (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... or rabbit anti-DsRed (1:2000; Takara Bio Cat# 632496, RRID:AB_10013483) in block at 4°C overnight ...
-
bioRxiv - Cancer Biology 2023Quote: ... Each reaction received 1 unit Titanium Taq polymerase (TaKaRa cat. #: 638517). All steps prior to amplification were performed RNase-free ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 million Lenti-X HEK293T cells (Takara Bio, cat. no. 632180) were seeded in 2 mL DMEM (Gibco ...
-
bioRxiv - Cancer Biology 2023Quote: ... retroviral supernatant was added onto retronectin-coated (1:25; #T100B TaKaRa) non-tissue culture treated plates and centrifuged at 2000 ×g for 60 min at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... Tet-On Inducible Expression System® plasmid (Clontech, Cat.No. 1. 634301) was linearized by digestion with EcoRI and AgeI ...
-
bioRxiv - Cancer Biology 2023Quote: ... The transduced cells were selected using puromycin (1 μg/ml; Clontech) for five days ...
-
bioRxiv - Cell Biology 2023Quote: ... The supernatant was incubated with 1 ml NiNTA Superflow resin (Takara) overnight rotating at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... GFP (Living Colors, Takara Biotech, San Jose CA, 632375; 1:2000), Pfn1 (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... tissues were stained using rabbit anti-dsRed (1:1000, #632496, Clontech) and mouse nc82 (1:30 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The antibody used was rabbit polyclonal DsRed (632496; TaKaRa, 1:500).
-
bioRxiv - Cancer Biology 2023Quote: ... to 7.5μL eluted RNA 2.5μL smRNA mix 1 (Takara Cat. #635031) and 1μL 10uM UMI RT primer (seq ...
-
bioRxiv - Microbiology 2024Quote: ... and 90 μl of DNase I (1 U/μl) (TAKARA, Japan). The suspension was thoroughly re-suspended ...
-
bioRxiv - Biochemistry 2020Quote: ... U-[15N,12C,2H]-labelled REC3 domain was overexpressed in BL21(DE3) cells containing chaperone plasmid pG-KJE8 (TAKARA, 3340) in M9 medium in 2H2O containing 2 g l−1 2H12C glucose (Sigma #552003 ...
-
bioRxiv - Cell Biology 2020Quote: ... These ligated pools were then amplified using AdR_PCR oligonucleotides as primer (5′-GGTCGCGGCCGAGGATC-3′) (IDT) and Advantage cDNA polymerase mix (Clontech, 639105). Amplicons were electrophoresed in 1% agarose gel to check for amplification and the size distribution of the library and then column purified (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: ... TTAGCTAGCCTTCTGATGTGATAGTTTATC TTCTG-3’ were used to amplify the 3xFLAG-BBS10 from the BBS10 ORF plasmid using CloneAmp HiFi PCR premix (Takara), which was further cloned into the CD520A-GFP plasmid via XbaI and Nhe I restriction sites ...
-
bioRxiv - Developmental Biology 2021Quote: ... Specific forward and reverse primers (Suppl Table 3) were designed using the In-Fusion Cloning Primer Design Tool from TaKaRa (https://www.takarabio.com/learning-centers/cloning/primer-design-and-other-tools ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting plasmids were co-transformed into Saccharomyces cerevisiae strain AH109 according to the protocols in the Matchmaker GAL4 Two-Hybrid System 3 (Clontech). The yeast cells were cultured on SD/-Leu-Trp (-LW ...
-
bioRxiv - Molecular Biology 2021Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described [18] (ii ...