Labshake search
Citations for Takara Bio :
51 - 100 of 1122 citations for SARS CoV 2 Spike Glycoprotein S2 aa 800 1000 His Tag E. coli since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... University of York) in frame with an N-terminal His tag and Im9 solubility tag (37) using In-Fusion cloning (Takara). Primers used for gene amplification were 5’-TCCAGGGACCAGCAATGCTTTCTGAGGAAGAGCAAAAAC-3’ and 5’-TGAGGAGAAGGCGCGTTAAAAGCGATAGCGGTAGCGGATG-3’ for UBA1a ...
-
bioRxiv - Microbiology 2023Quote: ... templates with primers encoding a His-tag and NcoI/NotI cut sites (Takara), cloned into pET22b ...
-
bioRxiv - Biochemistry 2023Quote: ... CBS proteins with a permanent C-terminal His-tag were purified using TALON (Clontech) resin followed by anion exchange using a Hitrap Q column (Cytiva) ...
-
bioRxiv - Microbiology 2020Quote: ... the His-tagged spike protein produced in the culture supernatants was purified with a Talon resin (Clontech).
-
bioRxiv - Microbiology 2023Quote: ... anti-E-cadherin (clone ECCD-2) (Takara), goat anti-rat488 (Thermo Fisher) ...
-
bioRxiv - Biophysics 2023Quote: WT and R203M N175-245were purified using the TALON His-tag purification protocol (Clontech Laboratories). Cell pellets were lysed in high salt buffer (50 mM tris ...
-
bioRxiv - Microbiology 2024Quote: ... reactions were performed to insert these linear fragments into the pMV306 previously digested with EcoRV and transformed into Escherichia coli (E. coli) Stellar TM competent cells (Takara Bio), purified (NucleoSpin Plasmid ...
-
bioRxiv - Cell Biology 2023Quote: ... E-cadherin antibody (HECD-1, 1:1000 IF, 1:1000 WB) was from Takara Bio ...
-
bioRxiv - Biophysics 2019Quote: ... Cells were harvested and purified using TALON His-Tag Purification protocol (Clontech Laboratories, Mountain View, CA.) The SUMO tag was cleaved by Ulp-1 as described above and the protein was further purified using ion-exchange chromatography (Bio-Rad ...
-
bioRxiv - Systems Biology 2023Quote: ... Ligated plasmid products were transformed into stellar competent cells (E. coli HST08 strain, Takara Bio). See Table S1 for full descriptions of constructs.
-
bioRxiv - Microbiology 2021Quote: ... The pcDNA3.4 expression vector containing the sequence that encodes the His-tagged extracellular domain of the spike protein was transfected into Expi293 cells and the His-tagged spike protein produced in the culture supernatants was then purified with a Talon resin (Clontech).
-
bioRxiv - Immunology 2023Quote: ... RVFV L segment RNA and SARS E RNA were detected with PrimeDirect™ Probe RT-qPCR Mix (Takara, RR650A) according to manufacturer’s instructions using RVFV L primers fwd 5’ TGAAAATTCCTGAGACACATGG 3’ ...
-
bioRxiv - Systems Biology 2023Quote: ... was used as the wild-type (WT) strain for genetic manipulations. Chemically competent Escherichia coli (E. coli) DH5α and HST08 (Stellar Competent Cells, TaKaRa Bio Inc., Kusatsu, Shiga, Japan) were used as the host strains for molecular cloning.
-
bioRxiv - Developmental Biology 2020Quote: ... anti-E-Cad 1:200 (M108, clone ECCD-2, TaKaRa), anti-Nanog 1:200 (eBIO-MLC51) ...
-
bioRxiv - Biophysics 2021Quote: ... Constructs containing both His and Strep tags were purified using gravity flow columns containing His60 Ni-NTA resin (Clontech) followed by Streptactin affinity chromatography (IBA Lifesciences ...
-
bioRxiv - Biophysics 2021Quote: ... A cDNA coding for 128QHTT with C-terminal fusion to a FLAG-His affinity tag was cloned into the vector pTRE-tight-BI-AcGFP1 (Clontech) for expression of 128QHTT upon induction with Dox ...
-
bioRxiv - Molecular Biology 2019Quote: ... The cell debris was removed upon centrifugation and the proteins were purified from the supernatant by His-tag affinity chromatography using Ni-NTA agarose beads (Clontech). The bound proteins were washed with lysis buffer containing 10 mM imidazole and then eluted with lysis buffer containing 250 mM imidazole ...
-
bioRxiv - Biochemistry 2019Quote: ... The cell debris was removed upon centrifugation in a SS34 rotor at 4 °C (27,000 × g for 15 min) and the proteins were purified from the supernatant by His-tag affinity chromatography using Ni-NTA agarose beads (Clontech). The bound proteins were washed with lysis buffer containing 25 mM imidazole and then eluted with lysis buffer containing 500 mM imidazole ...
-
bioRxiv - Molecular Biology 2019Quote: A DNA fragment containing CDS of each Hero protein and C-terminal FLAG and His tags was inserted into pCold I (Takara) by NEBuilder HiFi DNA Assembly Master Mix (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The N-terminal His tag construct of human MPST was co-transformed with GroES-EL chaperon plasmid from Takara (#3340), overexpressed in E ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR product was purified and ligated into the pET15b vector with a C-terminal His tag to create plasmid pET-AdpA by using the ClonExpress™ II One Step Cloning Kit (TaKaRa). The plasmid was transformed into E ...
-
bioRxiv - Cell Biology 2020Quote: ... an MBP-tag and a TEV protease recognition site (His-MBP-TEV) by Infusion® HD Cloning kit (Takara Bio, USA). The fidelity of the constructs was confirmed by gel electrophoresis and sequencing.
-
bioRxiv - Synthetic Biology 2021Quote: ... which contains a six-amino acid His-tag for the creation of a N-terminal fusion using the In-Fusion HD cloning kit (Clontech, USA).
-
bioRxiv - Cell Biology 2022Quote: ... were run onto 8% SDS- polyacrylamide gels that were transferred to nitrocellulose membranes which were reacted with α-His tag antibody (#631212, Clontech). Quantitation of band intensities was done with ImageLab software (BioRad) ...
-
bioRxiv - Microbiology 2020Quote: ... The viral 5’UTR with the 12 aa region and the 12 aa region on its own were cloned into pAcGFP1-C1 (Takara Biotech) using restriction-free cloning ...
-
bioRxiv - Plant Biology 2021Quote: ... Recombinant proteins were induced by 1 mM IPTG at 16°C for 20 h, then purified by a GST-tag Protein Purification Kit (Beyotime, Shanghai, China) or His TALON Purification Kit (Takara, Beijing, China). Corresponding primers are listed in Supplemental Table S2.
-
bioRxiv - Immunology 2024Quote: ... genes encoding the variable regions of C7 and C74 heavy chains were cloned into a pMN vector with a human CH1 domain and a C-terminal His-tag using In-Fusion cloning system (Takara Bio #639649). The full light chains of C7 and C74 were cloned into the pMN vector without any purification tag using the same method ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... His (Clontech), supplemented with 1.5 mM 3-amino-1,2,4-triazol (3-AT ...
-
bioRxiv - Microbiology 2020Quote: ... digested spike backbone vectors (Takara).
-
bioRxiv - Immunology 2022Quote: The total RNA of the cell samples was extracted with 1000-800 µl RNAiso Plus reagent (Takara, Kyoto, Japan) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 800 μL of dNTPs (Takara), 50 μL of P5 stagger primer mix (stock at 100 μM concentration) ...
-
bioRxiv - Bioengineering 2022Quote: ... 800 μL of dNTPs (Takara), 50 μL of P5 stagger primer mix (stock at 100 μM concentration) ...
-
bioRxiv - Genomics 2021Quote: ... 800 µL of dNTPs (Takara), 50 µL of P5 stagger primer mix (stock at 100 µM concentration) ...
-
bioRxiv - Genetics 2020Quote: ... 800 μL of dNTPs (Takara), 50 μL of P5 stagger primer mix (stock at 100 μM concentration) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 800□μL of dNTPs (Takara), 50□μL of P5 stagger primer mix (100□μM) ...
-
bioRxiv - Genomics 2023Quote: ... 800 μL of dNTPs (Takara), 50 μL of P5 stagger primer mix (stock at 100 μM concentration) ...
-
bioRxiv - Genomics 2023Quote: ... 800 uL of dNTPs (Takara), 50 uL of P5 stagger primer mix (stock at 100 uM concentration) ...
-
bioRxiv - Developmental Biology 2021Quote: ... –His (630428, Clontech) or –Trp ...
-
bioRxiv - Developmental Biology 2021Quote: ... –His (630419, Clontech) selective media +3 mM ...
-
bioRxiv - Plant Biology 2022Quote: ... and His (Clontech) with and without the addition of 3-Amino-1H-1,2,4-triazole (Acros Organics (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of Spike expressor and 2 μg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 293T cells ...
-
bioRxiv - Genomics 2021Quote: ... coli HST08 (used to test coregulation of genes in newly-formed operons and for vector construction; E. coli HST08 Premium Competent Cells, Takara Bio, Japan, 9128).
-
bioRxiv - Microbiology 2020Quote: ... coli (Clontech), extracted and retransformed into EAW19 ...
-
bioRxiv - Cell Biology 2021Quote: ... the Lenti-XTM Packaging Single Shots (vesicular stomatitis glycoprotein pseudotyped version) system from Takara Bio Europe was used according to the manufacturer’s instructions (631275) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Each sample was directly lysed in 4 μL of lysis buffer (including 0.2 μL of 1:1000 diluted external RNA controls consortium (ERCC) spike-in) and immediately reverse-transcribed using the PrimeScriptTM II Reverse Transcriptase (Takara, Cat# 2690A), and the cDNA library was constructed as the published Smart-seq2 method ...
-
bioRxiv - Cancer Biology 2020Quote: ... 800 μl of dNTP (Takara Bio), 50 μl of P5 primer (stock at 100 μM concentration) ...
-
bioRxiv - Developmental Biology 2023Quote: ... anti-Ocn (Takara, M173; 1:800), anti-CD31 (BD ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-His (Clontech 631212), anti-H3K36me2 (Upstate 07-369) ...
-
bioRxiv - Developmental Biology 2024Quote: ... The samples were stained with anti-mouse E-cadherin monoclonal antibody ECCD-2 (1:100, Takara) for 16 h at 4°C ...