Labshake search
Citations for Takara Bio :
451 - 500 of 1122 citations for SARS CoV 2 Spike Glycoprotein S2 aa 800 1000 His Tag E. coli since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-DsRed (1:1000) (632496, Clontech), goat anti-CGRP (1:500 ...
-
Targeted attenuation of elevated histone marks at SNCA alleviates α-synuclein in Parkinson’s diseasebioRxiv - Neuroscience 2020Quote: ... Anti-Cas9 antibody (Takara, 632607; 1:1000) and anti-GFP antibody (Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... and anti-GFP 1:1000 (Clontech, 632380), anti-α-syn 1:1000 (C-20 ...
-
bioRxiv - Neuroscience 2021Quote: ... Immunohistochemistry for mCherry (mouse, 1:1000, Takara; goat anti-mouse-alexa594 ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse-anti-mCherry (Clontech, 632543 1:1000). Secondary antibodies ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-H3K27me1 (1:1000, Takara, #MABI0321-100I), anti-H3K27ac (1:4000 ...
-
bioRxiv - Neuroscience 2019Quote: ... anti-dsRED 1:1000 (Clontech, Cat.no. 632496), anti-Tbr1 1:1000 (Abcam ...
-
bioRxiv - Genetics 2020Quote: ... including rabbit anti-RFP (Clontech, 1:1000), mouse anti-V5 (MCA1360GA ...
-
bioRxiv - Neuroscience 2022Quote: ... and rabbit anti-dsRed (1:1000; Takara). The following corresponding Alexa Fluor™ conjugated secondary antibodies (1:750 ...
-
bioRxiv - Neuroscience 2023Quote: ... and rabbit anti-mCherry (1:1000, TaKaRa Living Colors DsRed Polyclonal Ab 632496) ...
-
bioRxiv - Neuroscience 2023Quote: ... and anti-DsRed (1:1000, rabbit; Clontech). Secondary antibodies used were as follows ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-DsRed (1:1000; TaKaRa #632496). The brain sections were washed three times with PBS before incubation in secondary antibody for 1 hour at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... rabbit anti-DsRed (1:1000, Clontech #632496), mouse anti-RFP (Invitrogen (RF5R) ...
-
bioRxiv - Neuroscience 2023Quote: ... and rabbit anti-dsRed2 (1:1000, Clontech). The following secondary antibodies were used ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-dsRed (Takara #632496. 1:1000), chicken anti-GFP (Abcam #13970 ...
-
bioRxiv - Neuroscience 2024Quote: ... Rabbit Anti-dsRed (Takara 632496, 1:1000); Goat Anti-Calb2 (Swant CG1 ...
-
bioRxiv - Biochemistry 2020Quote: ... Proteins were expressed in Escherichia coli strain BL21(DE3) cells containing chaperone plasmid pG-KJE8 (TAKARA, 3340). When the optical density at 600 nm reached 0.6 ...
-
bioRxiv - Cell Biology 2020Quote: ... coli cells and purified to near-homogeneity by metal-affinity chromatography using TALON resin (Takara Bio, USA). After purification ...
-
bioRxiv - Molecular Biology 2020Quote: ... One µg of total RNA was used as input for SMARTer Stranded Total RNA Sample Prep Kit-HI Mammalian (Clontech). Sequencing was performed on the NextSeq500 instrument (Illumina ...
-
bioRxiv - Neuroscience 2021Quote: ... Clover-(His)6-LactC2 was purified from the supernatant with 3mL of the TALON superflow metal affinity resin (Clontech, CA). The resin was washed with 5 mM imidazole in PBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... Beads were washed twice with Pulldown Buffer and ran on SDS-PAGE followed by western blotting (anti-His Clontech 631212).
-
bioRxiv - Plant Biology 2021Quote: ... Ten colonies picked up with a tooth pick were diluted in 1ml 0.9%NaCl and spotted onto SD/-Ade/-His/-Leu/-Trp medium (Clontech, 630428) with or without a-X-Gal (GoldBio ...
-
bioRxiv - Biochemistry 2022Quote: ... The induction of His-and GST-fusion proteins and their subsequent purification using TALON® Metal Affinity Resin (Clontech Laboratories) and Glutathione SepharoseTM 4 Fast Flow beads (GE Healthcare) ...
-
bioRxiv - Biochemistry 2022Quote: ... Recombinant His-tagged protein was purified from cell-free extracts using immobilised metal affinity chromatography (IMAC using Talon resin; Clontech) as described previously (34) ...
-
bioRxiv - Microbiology 2022Quote: ... One μg of total RNA was used as input for SMARTer Stranded Total RNA Sample Prep Kit-HI Mammalian (Clontech). Sequencing was performed on the NextSeq500 instrument (Illumina ...
-
bioRxiv - Physiology 2022Quote: ... and cDNA libraries were generated using SMARTer Stranded Total RNA Sample Prep Kit - HI Mammalian (Takara Bio, Inc., Kusatsu, Japan). Libraries were high-output single-end sequenced on a NextSeq500 instrument (Illumina ...
-
bioRxiv - Biochemistry 2022Quote: A DNA fragment coding C-terminally His-tagged Gtsf1 or Gtsf1L was amplified by PCR and cloned into pCold vector (Takara) by In-fusion cloning kit (Takara) ...
-
bioRxiv - Microbiology 2022Quote: ... His-tagged AmiC was isolated from the protein sample using a TALON® metal affinity resin (Takara Bio USA, Inc) as previously described (51 ...
-
bioRxiv - Biochemistry 2022Quote: ... a DNA fragment encoding residues 1-132 was amplified using the RPA expression plasmid as a template and CloneAmp Hi-Fi PCR master mix (Clontech, Takara) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was obtained by centrifugation of the cell lysate at 10,000 g for 30 minutes and applied into the His TALON™ gravity column (Clontech). The columns were washed to remove the non-target proteins ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting amplicons were cloned into pKTS786 (a pcDNA 3.1/V5-His based vector) that had been linearized with BstX1 with an In-Fusion HD cloning kit (Takara 638909) (76) ...
-
bioRxiv - Plant Biology 2023Quote: ... and the input and pull-down prey proteins were detected by immunoblot using anti-His (M201, Takara, 1:3000 dilution) and anti-GST (G018 ...
-
bioRxiv - Bioengineering 2023Quote: ... GA-MatryoshCaMP6s was amplified from pRSET B His-GA-MatryoshCaMP6s and subcloned into pDONR /Zeo via In-Fusion cloning (Takara Bio ...
-
bioRxiv - Molecular Biology 2020Quote: ... To generate the light-inducible clustering constructs, the CRY2olig sequence (Taslimi et al., 2014a) was inserted with a c-terminal mCherry tag (Clontech) into pGEMHE to generate pGEMHE-CRY2olig-mCherry ...
-
bioRxiv - Developmental Biology 2019Quote: ... The human HSF2-YFP was constructed by PCR and cloned into the XhoI and SalI sites in frame with the N-terminal YFP tag in EGFp-C1 plasmid using In-Fusion Kit (Clontech). All PCR-amplified products for both plasmids were sequenced to exclude the possibility of second site mutagenesis ...
-
bioRxiv - Developmental Biology 2019Quote: ... plasmid after digestion of the inserts by EcoRI and KpnI and cloning into the EcoRI and EcoRV sites in frame with the C-terminal Flag tag in pSNAPf plasmid using In-Fusion Kit (Clontech). The human HSF2-YFP was constructed by PCR and cloned into the XhoI and SalI sites in frame with the N-terminal YFP tag in EGFp-C1 plasmid using In-Fusion Kit (Clontech) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and a modified vector with an N-terminal AviTag for biotinylation and C-terminal His6-tag (p28BIOH-LIC) using a ligation-independent InFusion cloning kit (ClonTech) and verified by DNA sequencing ...
-
bioRxiv - Microbiology 2019Quote: ... These PCR products were cloned into pCA24N with a C-terminal GFP tag using the In-Fusion HD enzyme kit (Takara). Clones were selected on TSA plates with 50µg/ml chloramphenicol ...
-
bioRxiv - Cancer Biology 2019Quote: ... containing a c-terminal Influenza Hemagglutinin (HA) reporter tag was cloned into the backbone pLX317-empty using the In-Fusion cloning kit (Clontech). The backbone was cut with BamHI and EcoRI.
-
bioRxiv - Cell Biology 2021Quote: ... cells were stably transfected with a plasmid encoding human full-length keratin 8 with an EYFP tag at its carboxyterminus (Windoffer et al., 2004; recloned into pEYFP-N1 (Clontech) with BamHI and EcoRI) ...
-
bioRxiv - Biochemistry 2020Quote: ... Full-length EGFP fused N-terminally to a nuclear localization signal (NLS) and C-terminally to a Myc-tag was expressed from pCMV (Clontech).
-
bioRxiv - Microbiology 2019Quote: ... mIRE1-wt was PCR-amplified (without a myc tag) from pcDNA3-mIRE1-3xmyc (Stahl et al, 2013) and subcloned in pMSCVhyg (Clontech) using BglII and HpaI sites ...
-
bioRxiv - Cell Biology 2022Quote: 3’ NotI-STOP-ORD5_Rv GCACA GCGGCCGC ctactgtggccggagggctggtcg For the HA-ORP5 cloning the PCR product (carrying the HA tag at the N-terminus of ORP5) was ligated between AgeI and XhoI in the pEGFP-C1 vector (Clontech) and replacing the GFP- with the HA-tag ...
-
bioRxiv - Microbiology 2020Quote: ... Total viral DNA was extracted using Qiagen viral DNA extraction kit (QIAamp DNA Mini Kit, Hilden, Germany) and DNA polymerase Tag (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmid pTAP-AFAP was constructed by cloning the gene fragment encoding AFAP-streptavidin-binding peptide-3xFLAG tag fusion protein (AFAP-SBP-3xFLAG, shorted as AFAP-SF) into mammalian expression vector pIRESpuro3 (Takara). SBP is a peptide with the length of 38 amino acids (Wilson et al. ...
-
bioRxiv - Pathology 2019Quote: ... and 1-1249 (full-length) were cloned into an EGFPC1 plasmid (N-terminal GFP tag) (Takara Bio, Mountain View, CA). For cleavage site validation experiments ...
-
bioRxiv - Genomics 2019Quote: ... we prepared whole genome sequencing libraries using 1 ng input from healthy volunteer samples using ThruPLEX Tag-seq (Takara Bio). We performed sequencing on HiSeq 4000 (Illumina ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... were subcloned into a pcDNA3.1 vector for mammalian expression and a C-terminal HA-tag (YPYDVPDYA) was add using In-Fusion HD Cloning technology (Clontech). A plasmid encoding the G protein chimera GqGi3 bearing the core of human Gαq and the last 4 amino acid of Gαi3 was generated by primer mutagenesis and In-Fusion HD Cloning (Clontech ...
-
bioRxiv - Neuroscience 2021Quote: ... AP-MDGA1 and AP-MDGA2 were generated by replacing the V5 tag of the V5-MDGA1 and V5-MDGA2 constructs respectively by the 14 amino acids AP tag (5’GGCCTGAACGAtATCTTCGAGGCCCAG AAGATCGAGTGGCACGAG3’) using the HD-In-Fusion kit (Takara). The linker 5’GGAGGATCAGGAGGATCA3’ was added after the AP tag ...
-
bioRxiv - Biophysics 2020Quote: pDNA_HaloTag/SNAP-tag/GFP vectors encoding each target protein (see Note 1),which were inserted by In-Fusion HD Cloning Kit (Clontech) or Seamless Ligation Cloning Extract (SLiCE ...