Labshake search
Citations for Takara Bio :
801 - 850 of 1429 citations for BFF 122 CAS 1152314 49 2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: ... Membranes were baked for 2 h at 80°C and prehybridized in ExpressHyb (Clontech, Mountain View) at 65°C for 1h ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 RBDs were purified using 1 or 5 ml HisTALON superflow cartridges (Takara Bio) and subsequently buffer exchanged into Cytiva 1x HBS- N buffer or PBS.
-
bioRxiv - Cell Biology 2021Quote: ... and reverse transcription of 2 μg of RNA was performed using PrimeScript RT Master Mix (TaKaRa). RT-qPCR was performed with SYBR Premix Ex Taq ((Tli RNaseH Plus) ...
-
bioRxiv - Plant Biology 2021Quote: ... Co-transformants were selected by cultivation for 2 days on minimal synthetic defined (SD) media (Clontech) lacking Leu (pACT2-GW ...
-
bioRxiv - Microbiology 2022Quote: ... SARS-CoV-2 Beta RBD was purified using a 5 mL HisTalon Superflow cartridge (Takara Bio) followed by buffer exchange into PBS using a HiPrep 26/10 desalting column (Cytiva).
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 RBDs were purified using 1 or 5 mL HisTALON superflow cartridges (Takara Bio) and subsequently buffer exchanged into 1x HBS-N buffer (Cytiva ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA (2 μg) was used for reverse transcription with the PrimeScriptTM RT reagent Kit (TaKaRa). Quantitative expression assays were performed by using the 2x M5 HiPer SYBR Premix EsTag kit (Mei5bio ...
-
bioRxiv - Microbiology 2021Quote: ... two to four overlapping DNA fragments were PCR amplified (Advantage HF 2 PCR Kit from Clontech) using primers described Table S4 ...
-
bioRxiv - Molecular Biology 2021Quote: Primers were designed using the Takara Bio Perfect Real Time Support System (Takara Bio, Table 2). Primers were diluted to 50 µM in ddH20 and stored at -20°C ...
-
bioRxiv - Physiology 2021Quote: ... Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Immunology 2020Quote: ... PCR samples were indexed with Nextera Illumina Indices reads using the Advantage 2 PCR kit (Clontech) in a 8 PCR cycle reaction and purified with Agencourt AMPpure XP beads (Beckman Coulter ...
-
bioRxiv - Immunology 2021Quote: ... AAV6 vector genomes were titrated by ITR-specific quantitative PCR (Takara AAVpro Titration Kit Ver.2) per the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2022Quote: ... Yeast transformation was performed according to the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, Japan). The primers used are listed in Supplemental Table S1.
-
bioRxiv - Plant Biology 2022Quote: ... bHLH39-1 and bHLH39-2 fused to the BD were co-transformed into yeast Y2HGold (Clontech). Transformants were grown on SD-Leu-Trp plates ...
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV-2 RBDs were purified using a Cobalt affinity column (HisTALON Superflow column from Takara or HiTrap TALON crude column from Cytiva ...
-
bioRxiv - Developmental Biology 2024Quote: ... The samples were stained with anti-mouse E-cadherin monoclonal antibody ECCD-2 (1:100, Takara) for 16 h at 4°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of genomic DNA was used as a template using Titanium Taq PCR kit (Takara). The sequence information for the primers used for barcode amplification was kindly provided by Novartis and can be found in Supplementary Table 4 ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Immunology 2022Quote: ... and treated with Exonuclease I (New EnglandBiolabs) before amplification by the Advantage 2 PCR kit (Clontech) and the SINGV6 primer (95°C for 1 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 μl of the PCR product was treated with 2 μl cloning enhancer (Takara-bio Inc.). The cloning reaction was prepared by adding 2 μl of 5X In-Fusion HD Cloning enzyme mix ...
-
bioRxiv - Plant Biology 2023Quote: ... and gametandiopore of one-month-old Tak-1 and Tak-2 by NucleoSpin RNA Plant (Takara) or Monarch Total RNA Miniprep Kit (New England BioLabs ...
-
bioRxiv - Biochemistry 2023Quote: ... LayV G was purified from clarified supernatants using 2 mL of cobalt resin (Takara Bio TALON), washing with 200 column volumes of 50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Developmental Biology 2023Quote: Yeast two-hybrid assays were performed according to the Yeastmaker Yeast Transformation System 2 manual (Clontech). The yeast strain AH109 was co- transformed with an AD-fused and a BD-fused construct using the lithium acetate method ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of RNA was converted to cDNA using PrimeScript 1st Strand cDNA Synthesis Kit (TaKaRa) in SureCycler 8800 (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... Second strand synthesis and PCR amplification was performed by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Molecular Biology 2023Quote: ... or 100 ng of genomic DNA was amplified with Advantage GC 2 polymerase (Takara Bio 639114) using 1 M GC Melt and primers spanning the region from upstream of the splice donors to the 3’ end of the repeat ...
-
bioRxiv - Plant Biology 2024Quote: ... First-strand cDNA was synthesized using 2 μg RNA and PrimeScript RT Master Mix (Takara Bio). qRT-PCR was performed using the first-strand cDNAs diluted 5-fold in water and KAPA SYBR FAST qPCR Master Mix (2x ...
-
bioRxiv - Cancer Biology 2024Quote: ... Viral supernatant was collected 2 days post-transfection and concentrated using Lenti-X lentivirus concentrator (Clontech). Cells were then infected with the concentrated lentivirus ...
-
bioRxiv - Cell Biology 2020Quote: ... The expression construct coding for eGFP-NLS was produced from pEGFP-N1 (Takara Bio USA, Inc., Mountain View, CA, USA) accordingly ...
-
bioRxiv - Microbiology 2020Quote: ... DNA sequences that flanked the ittA sRNA locus were amplified using PCR with PrimeSTAR GXL polymerase (Takara, Mountain View, CA). For the upstream fragment ...
-
bioRxiv - Neuroscience 2021Quote: ... Clover-(His)6-LactC2 was purified from the supernatant with 3mL of the TALON superflow metal affinity resin (Clontech, CA). The resin was washed with 5 mM imidazole in PBS ...
-
bioRxiv - Genomics 2020Quote: ... All on-chip thermal cycling was performed using a SMARTer™ ICELL8® Thermal Cycler (Takara Bio USA, CA, USA).
-
bioRxiv - Plant Biology 2019Quote: ... The JAZ coding sequences were ligated into the multi-cloning site of the Y2H vector pB42AD (Clontech, Mountain View, CA) to generate N-terminal fusions to the B42 transcriptional activation domain ...
-
bioRxiv - Plant Biology 2019Quote: ... The RxL10 CDS was recombined from pDONR207 into a Gateway compatible version of the Y2H vector pGilda (Clontech, Mountainview, CA) to generate an N-terminal fusion to the LexA DNA binding domain ...
-
bioRxiv - Biophysics 2019Quote: ... and the full mNeonGreen coding sequence was inserted in its place using In-Fusion cloning (Takara Bio; Mountain View, CA). NG-Scarlet and NG-Cherry were created by deleting mRuby3 from NG-Ruby3 by inverse PCR and insertion of either mScarlet-I or mCherry using In-Fusion cloning (Takara Bio) ...
-
bioRxiv - Developmental Biology 2019Quote: ... flowthrough and input samples were prepared for sequencing using the SMARTer Stranded RNA-Seq Kit (Takara Bio, Mountain View, CA).
-
bioRxiv - Microbiology 2019Quote: ... verticillioides strain M3125 cDNA using Q5® High-Fidelity DNA Polymerase and inserted in pGADT7 (Clontech, Mountain View, CA, USA) as prey vectors ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was annealed to primers by the addition of 4 µL 100 µM Random Hexamer Primers (TaKaRa, Mountain View, CA) and incubation at 65°C for 5 min ...
-
The Ets protein Pointed P1 represses Asense expression in type II neuroblasts by activating TaillessbioRxiv - Developmental Biology 2021Quote: ... Tll or PntP1 coding region was amplified using the CloneAmp HiFi PCR Premix (Catalog# 639298, Takara Bio., Mountain View, CA) from a cDNA library and cloned into pcDNA™3.1/His expression vectors (Catalog #V38520 ...
-
bioRxiv - Plant Biology 2021Quote: ... and were used for cDNA synthesis and library preparation using SMARTer universal low input RNA kit (Clontech, Mountain View, CA). Library fragment size distribution was checked on the Agilent 2100 Tapestation System with the High Sensitivity D1000 Kit (Agilent Technologies) ...
-
bioRxiv - Microbiology 2022Quote: ... cells were transduced in 24-well plates precoated with recombinant fibronectin (FN CH-296, Retronectin Takara, Clontech, Mountain View, CA) with retroviral supernatants and expanded in complete medium (45% RPMI-1640 and 45% Click’s medium ...
-
bioRxiv - Microbiology 2022Quote: ... cells were transduced in 24-well plates precoated with recombinant fibronectin (FN CH-296, Retronectin Takara, Clontech, Mountain View, CA) with retroviral supernatants and expanded in complete medium (45% RPMI-1640 and 45% Click’s medium ...
-
bioRxiv - Plant Biology 2021Quote: ... All combinations were transferred to the SD/-Leu-Trp medium by the yeast strain Y2H (Clontech, Mountain View, CA, USA), and then transferred to the SD/-Leu-Trp medium ...
-
X-ray mediated scintillation increases synaptic activity via Cerium-doped LSO and Channelrhodopsin-2bioRxiv - Neuroscience 2020Quote: ... 36-48 h post transfection lentivirus containing media was harvested and concentrated using Lenti-X concentrator (Takara, Mountain View, CA) as per manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1999)) along with the primers listed in Table 1 and the In-Fusion HD cloning system (Takara, Mountain View, CA) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Y1H reporter plasmids pHISi-1-Sph2 were linearized by XhoI and stably integrated into the non-functional HIS3 locus of Yeast YM4271 by homologous recombination following the manufacturer’s instructions (Clontech, CA). To control basal expression of HIS3 reporter gene ...
-
bioRxiv - Pathology 2019Quote: ... and 1-1249 (full-length) were cloned into an EGFPC1 plasmid (N-terminal GFP tag) (Takara Bio, Mountain View, CA). For cleavage site validation experiments ...
-
bioRxiv - Bioengineering 2019Quote: ... the media was replaced and 0.5 μl Shield-1 ligand (0.5 mM stock, Takara Bio USA, Inc., Mountain View, CA) was added to each well to stabilize protein expression ...
-
bioRxiv - Neuroscience 2020Quote: Primary antibodies used in this study include rabbit anti-DsRed (1:2000; #632496; Takara Bio USA, Inc., Mountain View, CA), rabbit anti-mCherry (1:500 ...
-
bioRxiv - Genomics 2020Quote: Yeast one-hybridization assay was performed using the Matchmaker® Gold Yeast One-Hybrid System (Clontech, Palo Alto, CA, USA). The promoter sequence (upstream 2kb from the start codon ...