Labshake search
Citations for Qiagen :
3751 - 3800 of 6611 citations for SARS CoV 2 Spike Glycoprotein S1 His tag Insect Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... RNA was prepared from cells harvested one day post-transfection (RNeasy mini kit, Qiagen) and used for cDNA synthesis (iScript cDNA synthesis kit ...
-
bioRxiv - Microbiology 2023Quote: ... Harvested cells were re-suspended in 800 μl RLT buffer (RNeasy Mini Kit, Qiagen) with β-mercaptoethanol (10 μl ml-1 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Genomic DNA was amplified with the REPLI-g Advanced DNA Single Cell Kit (Qiagen), and successful amplification of chytrid DNA was verified by PCR with the primers ITS4ngsF (5’-GCATATCAATAAGCGSAGGA-3’ ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA was extracted from each cell line using a RNeasy Mini Kit (Qiagen). cDNA was synthesized with a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems ...
-
bioRxiv - Systems Biology 2023Quote: ... and 18 hours and cultured cells were harvested and fixed with RNAprotect (Qiagen 76506).
-
bioRxiv - Physiology 2023Quote: Hypoxic cells were lysed in Buffer RLT without β-mercaptoethanol (Qiagen, Germantown, MD, USA). RNA extractions were carried out using an RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... skin Ebf2- PαS cells and BM MSCs were isolated with RNeasy Micro Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: RNA was extracted from Mv1Lu cells using the RNeasy Mini Kit (Qiagen, Germantown, MD) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and genomic DNA was extracted using the Gentra Puregene Cell and Tissue Kit (QIAGEN) to obtain WGS data for Panagrolaimidae isolates ...
-
bioRxiv - Cell Biology 2023Quote: Total DNA was isolated from C2C12 cells using DNeasy Blood and Tissue Kit (Qiagen). qPCR was performed with SYBR™ Green qPCR Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: gDNA samples from cells were prepared with a DNeasy Blood & Tissue Kit (Qiagen, USA). The DNA fragments around the crRNA target site were amplified by a two-step PCR with specific primer sets (Table S2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 27 with minimal modifications on gDNA extracted using the Gentra Puregene Cell Kit (Qiagen) from two independent human T cell (CD3+ ...
-
bioRxiv - Microbiology 2023Quote: ... and cells were harvested by centrifugation for RNA extraction using RNeasy Mini Kits (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... the total RNA was extracted from cells using RNeasy Plus Mini Kit (QIAGEN, # 74134).
-
Autoimmune inflammation triggers aberrant astrocytic calcium signaling to impair synaptic plasticitybioRxiv - Neuroscience 2023Quote: ... Astrocytes purified by flow cytometry and cultured cells were collected in lysis buffer (Qiagen) containing 1% β-mercaptoethanol for optimal template preservation ...
-
bioRxiv - Microbiology 2023Quote: ... 5 ml samples of each culture were stabilized with RNA protect Cell Reagent (Qiagen) and subsequently collected by centrifugation at 5 000 x g for 10 min at 4◦C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Cells were kept at 37 LJ for 30 minutes and then purified by Qiagen MinElute Kit ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Genomic DNA was extracted from the cells using the DNeasy Blood & Tissue Kit (Qiagen). For library preparation prior to sequencing ...
-
bioRxiv - Immunology 2023Quote: ... Cellular RNA was isolated from sorted B cell subsets with RNeasy Micro Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... sorted cells were washed and RNA isolated using the RNeasy Plus Micro Kit (Qiagen) including a gDNA elimination step by QIAshredder spin columns (Qiagen).
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were collected for total RNAs isolation using RNeasy Plus Mini Kit (Qiagen, 74136). The same amount of total RNAs from each sample were reversely transcribed with PrimeScript RT Master Mix (TaKaRa ...
-
bioRxiv - Immunology 2023Quote: Genomic DNA from edited cells was extracted using the DNeasy Blood & Tissue Kit (Qiagen) and the percent edited alleles measured for an in-out PCR product ...
-
bioRxiv - Cell Biology 2023Quote: ... Total RNA was isolated from frozen cells using the RNeasy Mini kit (74104, Qiagen). Cells were resuspended as per manufacturer’s instructions for RNAse-rich cell lines using 2-MercaptoEthanol (Sigma-Aldrich ...
-
bioRxiv - Genomics 2023Quote: ... Total RNA was isolated from each cell line with the RNeasy Plus Kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was extracted from tumor cell pellets using RNeasy Mini Kit (Qiagen, 74106) and RNase-Free DNase Set (Qiagen ...
-
bioRxiv - Bioengineering 2023Quote: ... Neurons were harvested seven days post-transduction in cell lysis buffer (RLT+ buffer (Qiagen) + 1 % β-mercaptoethanol (Merck)).
-
bioRxiv - Biochemistry 2023Quote: Genomic DNA was extracted from cell pellets using QiaAMP DNA Mini Kit (Qiagen, 51306). Barcodes were PCR amplified using 5’- GATATTGCTGAAGAGCTTG and 5’- CCAGAGGTTGATTGTTCCAGA ...
-
bioRxiv - Bioengineering 2022Quote: Genomic DNA was extracted from monoclonal cells using DNeasy Blood and Tissue kit (Qiagen) following the instructions ...
-
bioRxiv - Genetics 2023Quote: ... Cells were harvested 72 hours after transfection using the RNeasy Plus Mini Kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... while RNA from cell monolayers was extracted using the Rneasy Plus Mini Kit (Qiagen).
-
bioRxiv - Cell Biology 2022Quote: Total RNA was isolated 5x106 cells using the RNAeasy Plus Mini kit (Qiagen, #74134). PolyA enrichment ...
-
bioRxiv - Cell Biology 2022Quote: Plasmid DNA transfections in HEK293FT cells were performed using Effectene transfection reagent (#301425, QIAGEN) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA of mutant cells was isolated using DNA Blood Mini Kit (QIAGEN, 51106) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: The total RNA in cells were extracted using RNeasy® Mini Kit (#74106 Qiagen) and the concentration and purity of the RNA were measured by nanodrop spectrometer ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were harvested and RNA extraction was performed using the RNeasy Kit (Qiagen, USA) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA from cultured cells or tissue samples was extracted using Qiazol reagent (Qiagen) and purified with RNA spin columns (Ecotech) ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA from cultured cells or tissue samples was extracted using Qiazol reagent (Qiagen) and purified with RNA spin columns (Ecotech) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 400,000 cells from each population were resuspended in 350 µL TCL lysis buffer (Qiagen) supplemented with 1 % β-mercaptoethanol ...
-
bioRxiv - Cancer Biology 2022Quote: ... cell pellets were resuspended in RLT lysis buffer from the RNeasy Mini Kit (Qiagen) and stored at −80°C until sufficient samples for three biological repeats had been collected ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was first isolated from the cells using the RNeasy Mini Kit (#74104, Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: We first extracted total RNA from cells using the Qiagen RNEasy kit(Qiagen 74004). We generated cDNA from the total RNA using the RDRT reagent (Sigma RDRT-100RXN ...
-
bioRxiv - Genomics 2023Quote: Total RNA was extracted from biological triplicate cell pellets using RNeasy Mini Kit (Qiagen) per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was isolated from cell lines using RNeasy Plus Mini Kit (QIAGEN, Cat. # 74134). Isolated RNA was used (1 μg ...
-
bioRxiv - Cancer Biology 2022Quote: Assays were performed in 293T cells using Cignal RARE Reporter Assay Kit (Qiagen 336841) as described previously (9).
-
bioRxiv - Cell Biology 2023Quote: ... and RNA was extracted from the cell pellets by RNeasy® Mini kit (QIAGEN) following the manufacturer protocol ...
-
bioRxiv - Systems Biology 2023Quote: ... total RNA was extracted from cell lysate by RNeasy Plus Mini Kit (Qiagen, 74136). Total RNA which was carried out following the method described above was removed rRNA by rRNA Depletion Kit (Vazyme ...
-
bioRxiv - Molecular Biology 2022Quote: Genomic DNA of edited cells was extracted using Blood & Tissue Kit (Qiagen, Cat# 69506). The UMI labeling was performed followed the published protocol 7 ...
-
bioRxiv - Cancer Biology 2023Quote: RNA was extracted from cells and mouse tumors using the miRNeasy kit (Qiagen, #217004) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: RNA was extracted from cell pellets using the RNeasy Plus mini kit (Qiagen #74136) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: Total RNA was extracted from sorted cells using RNeasy Mini Kits (Qiagen, Hilden, Germany), and the quality of the RNA was evaluated using an Agilent Bioanalyzer (Agilent Technologies ...