Labshake search
Citations for Qiagen :
3051 - 3100 of 6247 citations for hsa mir 150 3p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: ... purified using the QIAquick PCR purification kit (QIAGEN) and circularized with T4 DNA ligase ...
-
bioRxiv - Immunology 2022Quote: ... The DNA was purified (QIAquick PCR cleanup, Qiagen). The relative amounts of the genes that were precipitated by each antibody were measured by qPCR ...
-
bioRxiv - Molecular Biology 2020Quote: ... and purified with the PCR cleanup kit (Qiagen). Half of the eluate was redigested with NheI and half with PvuII (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was purified (MinElute PCR Purification Kit, Qiagen) and stored at −80°C ...
-
bioRxiv - Genomics 2019Quote: ... the DNA was purified (Qiagen PCR purification kit). dATP was added with Klenow exo- (NEB ...
-
bioRxiv - Genomics 2020Quote: ... followed by the MiniElute PCR purification kit (Qiagen). The quality of DNA was assessed using a 2100 Bioanalyzer instrument (Agilent) ...
-
bioRxiv - Molecular Biology 2021Quote: ... employing the QuantiTect SYBR Green PCR Kit (Qiagen). Each sample was analyzed in triplicates for transcript levels - given as cycle threshold (Ct ...
-
bioRxiv - Molecular Biology 2021Quote: ... and purified by MinElute PCR purification kit (Qiagen).
-
bioRxiv - Genomics 2019Quote: ... Individual PCR products were silica column-purified (Qiagen), inspected by TapeStation for their predicted amplicon size ...
-
bioRxiv - Biophysics 2019Quote: ... followed by PCR clean-up (Qiagen, cat# 28104). The cleaned PCR reactions were incubated for 4 hours with 1µL DpnI ...
-
bioRxiv - Microbiology 2019Quote: ... namely MinElute PCR Purification kit (Qiagen; Hilden, Germany), Monarch® PCR & DNA Cleanup Kit (5 μg ...
-
bioRxiv - Immunology 2019Quote: ... and cleaned with MinElute PCR Purification Kit (Qiagen). The amplicon TCR library was sequenced using the paired-end 300 bp Illumina MiSeq and the approximate number of paired-end reads generated per CD8 T cell population was ...
-
bioRxiv - Physiology 2020Quote: ... PCR was performed with Taq DNA polymerase (Qiagen). PCR products of correct sizes were extracted and cloned into pGEMT easy vectors (Promega) ...
-
bioRxiv - Biochemistry 2020Quote: ... using the QuantiFast SyBr Green PCR Kit (Qiagen) and the following primers ...
-
bioRxiv - Molecular Biology 2020Quote: The Qiagen SYBR Green PCR kit (Qiagen, Germany) was used for real-time PCR ...
-
bioRxiv - Bioengineering 2019Quote: ... Qiagen MiniElute PCR Purification (Cat. No. 28004, Qiagen), Q5® Hot Start High-Fidelity (Catalog # M0494S ...
-
bioRxiv - Biochemistry 2019Quote: ... with the QuantiNova SYBR Green PCR Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2020Quote: ... purified on a PCR cleanup column (Qiagen 28106), and ligated into BamHI/ HindIII-linearized and gel-purified pET28 ...
-
bioRxiv - Developmental Biology 2021Quote: ... then purified using QIAquick PCR purification kit (Qiagen). Amplicons were sequenced by Sanger sequencing using Exon2seqRev (CCCGCAATTACAACATGCTAG ...
-
bioRxiv - Synthetic Biology 2021Quote: ... purified using the QIAquick PCR Purification Kit (Qiagen) and eluted in 80 µL H2O ...
-
bioRxiv - Bioengineering 2020Quote: ... The resulting PCR amplicons were gel-purified (Qiagen) and processed for Sanger sequencing (Applied Biosystems 3730xL DNA Analyzer).
-
bioRxiv - Neuroscience 2021Quote: ... and the QuantiTect SYBR Green PCR Kit (Qiagen). Sequences of the different primer pairs used for PCR amplification of mouse and rat TPH2 and SERT cDNAs are listed in Supplementary Table S1.
-
bioRxiv - Microbiology 2021Quote: ... PCRs were performed using Taq DNA polymerase (Qiagen) and the primers listed in Table S2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5μl of Quanti tech probe PCR mix (QIAGEN), 1 μl of Taqman probe (1.5 μM) ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR products were gel-purified (Qiagen, Hilden, Germany), cloned into the non-directional Gateway PCR8 vector (Invitrogen ...
-
Biallelic loss-of-function OBSCN variants predispose individuals to severe, recurrent rhabdomyolysisbioRxiv - Genetics 2021Quote: ... The Rotor-Gene SYBR Green PCR Kit (Qiagen) was used to set up 10 μL reactions containing 1 μL diluted cDNA and 0.8 μM each of forward and reverse primers (OBSCN ...
-
bioRxiv - Immunology 2020Quote: ... purified using a Qiagen PCR cleanup kit (Qiagen), and finally sequenced on an Illumina HiSeq 2500 with a minimum read length of 75 bp to a minimum depth of 30 million reads per sample ...
-
DDK regulates replication initiation by controlling the multiplicity of Cdc45-GINS binding to Mcm2-7bioRxiv - Cell Biology 2020Quote: ... purified with a QIAquick PCR Purification Kit (Qiagen), and ligated with oligos each containing a Cy5- or BHQ-2 label and NotI sticky ends (NEB ...
-
bioRxiv - Genomics 2021Quote: ... or (B) a QIAquick PCR purification column (Qiagen) (proK-col) ...
-
bioRxiv - Cancer Biology 2022Quote: ... purified using the QIAquick PCR Purification Kit (Qiagen), and ligated into BsmBI-digested and dephosphorylated pUSEPR vector using high-concentration T4 DNA ligase (NEB) ...
-
bioRxiv - Biochemistry 2022Quote: ... and QIAquick PCR purification kit (Qiagen, Hilden, Germany), respectively ...
-
bioRxiv - Molecular Biology 2022Quote: ... using SYBR Green PCR Master Mix (204145, Qiagen) on a real time PCR machine (Bio-Rad CFX system) ...
-
bioRxiv - Microbiology 2022Quote: The human Hh signaling target PCR array (Qiagen) profiled the expression of 84 key genes responsive to Hh signal transduction ...
-
bioRxiv - Developmental Biology 2022Quote: ... Using the Qiagen minElute PCR purification kit (Qiagen). Purified DNA was quantified using Qubit dsDNA kit (Thermo ...
-
bioRxiv - Plant Biology 2021Quote: ... and QuantiTect SYBR® Green PCR Kits (Qiagen). Gene-specific primers were designed using Primer3 and blast was carried out using NCBI BLAST to determine any miss-priming (Table S1) ...
-
bioRxiv - Microbiology 2020Quote: ... and purified (QIAquick® PCR Purification Kit, Qiagen). The low-copy number vector ...
-
bioRxiv - Molecular Biology 2020Quote: ... on the Rotor-Gene-Q PCR cycler (Qiagen). The concentration of component used in final 25μL PCR reaction mix were as follows ...
-
bioRxiv - Neuroscience 2021Quote: ... and LNA SYBR green PCR kit (Qiagen, 339345). Relative-fold changes were normalized comparing exosomal micro RNA reference gene miR-30c-5p using the primer hsa-miR-30c-5p miRCURY LNA miRNA PCR Assay (Qiagen 339306 ...
-
bioRxiv - Plant Biology 2021Quote: ... using the Quantitec Probe PCR Master Mix (Qiagen) in a 25-µl reaction ...
-
bioRxiv - Microbiology 2021Quote: ... using the QuantiTect Sybr Green PCR kit (Qiagen). PCR conditions were 10 min at 90°C and 40 cycles of 15 s at 95°C and 1 min at 60°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Quantitative PCR was performed on a RotorGeneQ (Qiagen) cycler with the SYBR-Green Master mix (Qiagen ...
-
bioRxiv - Biochemistry 2020Quote: ... purified with the QIAquick PCR Purification Kit (QIAgen) and used as DNA templates for run-off in vitro transcription using MEGAscript SP6 kit (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was purified by PCR purification column (Qiagen) and analyzed by qPCR ...
-
bioRxiv - Genomics 2022Quote: ... purified using the QIAquick PCR Purification Kit (Qiagen), and ligated into BsmBI/Esp3I-digested and dephosphorylated pUSEBR ...
-
bioRxiv - Physiology 2022Quote: ... Quantitative PCR (qPCR) was performed for RNU6B (Qiagen) and miR-140 (Invitrogen ...
-
bioRxiv - Genetics 2019Quote: ... Following purification with a PCR purification kit (Qiagen), the product was electroporated into MegaX DH10B Electrocomp Cells (ThermoFisher ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 12.5µl of PyroMark PCR Master Mix (Qiagen, France), 2.5µl of CoralLoad concentrate (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: ... The miRCURY LNA miRNA PCR assay system (Qiagen) was used to detect specific miRNA expression ...
-
bioRxiv - Microbiology 2019Quote: ... and Rotor-Gene Multiplex PCR Kit reagent (Qiagen) using validated HHV-6-IE1- and GAPDH-specific primers and probes (41) ...
-
bioRxiv - Molecular Biology 2019Quote: ... followed by QuantiTec SYBR Green PCR kit (Qiagen). The RNAs were eluted with 14ul RNase-free water ...