Labshake search
Citations for Qiagen :
3201 - 3250 of 6247 citations for hsa mir 150 3p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... was in 50 ul:1X PCR Buffer (Qiagen), 1X Q-Solution (Qiagen) ...
-
bioRxiv - Genetics 2024Quote: ... PCR reactions were performed using Taq polymerase (Qiagen) according to the manufacturer’s directions ...
-
bioRxiv - Cancer Biology 2024Quote: ... and amplified using PCR with HotStar Taq (Qiagen). Mice in the study were bred in two sequential cohorts ...
-
bioRxiv - Microbiology 2024Quote: ... using a QIAcuity One Digital PCR System (QiagenⓇ). PCR conditions were 2 min at 95℃ ...
-
bioRxiv - Neuroscience 2024Quote: ... on a custom RT2 profiler PCR Array (QIAGEN) using a LightCycler® 96 (Roche) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... miRCURY LNA miRNA Custom PCR Assay (339317, QIAGEN).
-
bioRxiv - Biophysics 2024Quote: ... and column-purified (QIAquick PCR purification kit, QIAGEN) for Gibson assembly ...
-
bioRxiv - Bioengineering 2024Quote: ... purified with the QIAquick PCR Purification Kit (QIAGEN), and submitted to Sanger sequencing (Genewiz).
-
bioRxiv - Immunology 2024Quote: ... Amplicons were purified (MinElute PCR purification kit, Qiagen) and subsequently sequenced (Eurofins).
-
bioRxiv - Microbiology 2024Quote: ... purified using a QIAquick PCR purification kit (Qiagen), and sequenced (2x150 bp ...
-
bioRxiv - Microbiology 2024Quote: ... and purified using QIAquick PCR Purification Kit (Qiagen) [37] ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was purified (Qiagen MinElute PCR purification kit) and PCR amplified (7 cycles ...
-
bioRxiv - Biochemistry 2024Quote: ... QIAquick PCR purification kits were purchased from Qiagen. The Sequagel-UreaGel concentrate and diluent system for denaturing polyacrylamide gels was purchased from National Diagnostics ...
-
bioRxiv - Genomics 2024Quote: ... purified using the QIAquick PCR purification kit (QIAGEN), and used for T7 in-vitro transcription with MEGAshortscript Kit (Invitrogen) ...
-
bioRxiv - Physiology 2024Quote: ... using the QuantiNova SYBR Green PCR kit (QIAGEN) and QuantiTect primer assays (QIAGEN ...
-
bioRxiv - Microbiology 2022Quote: cDNA synthesis was carried out using DNA-free RNA with the RT First Strand Kit according to manufacturer’s instructions (Qiagen). Each cDNA sample was used at 120 ng/well in 96-well plates ...
-
bioRxiv - Immunology 2022Quote: For RT product measurements DNA was extracted from 5×105 infected cells using the DNeasy Blood & Tissue kit (QIAgen) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA was polyadenylated and cDNA was synthesized according to manufacturer’s instructions (miRCURY LNA RT Kit, 339340, Qiagen, Hilden, Germany). Expression of miRNAs was determined by Ready-to-Use Human panel I+II PCR ...
-
bioRxiv - Microbiology 2019Quote: ... Total RNA-derived cDNA (which includes cDNA derived from miRNA) was generated using the miScript II RT Kit (Qiagen) using the hiFlex buffer according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... For RT product measurements DNA was extracted from 5×105 infected cells using the DNeasy Blood & Tissue kit (QIAgen) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... 500 ng of total RNA was used for establishing the cDNA library with the miScript II RT Kit (Qiagen). qRT-PCR was performed with the SYBR Green I Master kit (Roche Applied Science ...
-
bioRxiv - Microbiology 2020Quote: ... Equal amounts of RNA samples were used for cDNA synthesis by QuantiTect reverse transcription (RT) kit according to the manufacturer’s instructions (Qiagen). qPCR was performed using the following primers ...
-
bioRxiv - Microbiology 2020Quote: Airway epithelia cultured on 6.5-mm Transwell membranes were washed and treated for 1 minute at RT with RLT buffer (Qiagen) with 1% β-mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2022Quote: ... For analysis of miRNA genes RNA was reverse-transcribed with the miRCURY LNA RT Kit (Qiagen, Hilden, Germany; 339340) followed by SYBR Green qPCR (miRCURY LNA SYBR Green PCR Kit ...
-
bioRxiv - Neuroscience 2022Quote: 50ng of total RNA isolated from microglia/bulk samples was reverse transcribed using the miRCURY LNA RT kit (Qiagen) in accordance with manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: ... The cDNA was synthesized from total RNA (0.1 – 1.0 µg) with miScript II RT Kit (Qiagen, Germantown, MD, USA). qRT-PCR was performed using miScript SYBR Green PCR Kit (Qiagen ...
-
bioRxiv - Pathology 2020Quote: ... microRNAs were determined as previously published from 100 pg of cDNA synthesized with the miScript RT kit (Qiagen, Milan). Real time PCR were analyzed using the relative quantification method previously described (23).
-
bioRxiv - Pathology 2020Quote: ... the total RNA (containing small RNAs) was subjected to miRNA reverse transcription using the miScript II RT Kit (Qiagen), following the manual ...
-
bioRxiv - Neuroscience 2021Quote: ... SYBR green RT-qPCR was performed in triplicate with 10 ng of template cDNA using QuantiTect Master Mix (Qiagen) on a 7900-HT Fast Real-time System (Applied Biosystems ...
-
bioRxiv - Cell Biology 2021Quote: The human VCP cDNA was reverse transcribed from total RNA by using Omniscript RT kit (Qiagen Japan, Tokyo, Japan) extracted from A549 cells (RIKEN Cell Bank ...
-
bioRxiv - Genomics 2020Quote: ... first strand synthesis was performed by incubating the pucks in 200 μL of reverse transcription solution (Maxima 1x RT Buffer, 1 mM dNTPs, 2 U/μL Lucigen NxGen RNAse inhibitor, 2.5 μM template switch oligo with Qiagen #339414YCO0076714 ...
-
bioRxiv - Microbiology 2022Quote: Airway epithelium cultured on 6.5-mm Transwell membranes was washed and treated for 1 min at RT with RLT buffer (Qiagen) with 0.01 % β-mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2023Quote: ... The lysate was cleared by centrifugation at 12’000 g for 30 min at RT and added to Ni-NTA agarose beads (Qiagen) equilibrated in lysis buffer ...
-
bioRxiv - Developmental Biology 2024Quote: ... Approximately 560ng of total RNA was converted to cDNA in a 20μl reverse transcription reaction using the Omniscript RT kit (Qiagen) and random primers (ThermoFisher Scientific) ...
-
bioRxiv - Genetics 2021Quote: ... and E11 (5’-AGGAAAAAGGAAATAAATTA-3’) primers on pDH373 as a template generated a smaller fragment that was cleaned up by QIAGEN MinElute PCR Purification Kit (#28004) ...
-
bioRxiv - Genetics 2020Quote: ... Target regions were PCR-amplified in technical triplicates from bilsulphite-converted DNA using a biotinylated forward or reverse primer and HotStarTaq DNA Polymerase (QIAGEN). PCR conditions were as follows ...
-
bioRxiv - Molecular Biology 2020Quote: ... using 1 µl of the cDNA product as template and either Fast Cycling PCR kit or HotStarTaq Plus Master Mix with a final concentration of 0.1 µM for each primer following the manufacturer’s protocols (Qiagen, Hilden, Germany). PREDICT universal controls 1 and 2 (Anthony et al. ...
-
bioRxiv - Genomics 2022Quote: ... The biotinylated single-stranded PCR products were then purified with Streptavidin Sepharose High Performance beads (Cytiva) and hybridized to sequencing primers (same as forward) on the PyroMark vacuum prep workstation (QIAGEN). Finally ...
-
bioRxiv - Neuroscience 2021Quote: ... and rplp0 (all QuantiTect Primer Assays: 18s Cat. No. QT02448082, gapdh Cat. No. QT01658692, hprt1 Cat. No. QT00166768, rplp0 Cat. No. QT00249375; Qiagen). We analyzed the relative expression of the following genes of interest ...
-
bioRxiv - Microbiology 2021Quote: ... and a high resolution melt curve (HRM) in the end] using the primers listed in Table S2 on a Rotor-Gene Q instrument (Qiagen). rnpB was taken as reference for all genes ...
-
bioRxiv - Immunology 2021Quote: ... 150 ng DNA per reaction was amplified in duplicate using primers and probes specific to γHV68 Orf50 and mouse Ptger2 (see table) and 2× QuantiNova Probe Mastermix (Qiagen). Standard curves were obtained by serial dilutions of Orf50 and Ptger2 gBlocks (ORF50 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 5µM of CONIPHY designed reverse and forward primers (P. viticola PyroID kit, CONIPHY, France) using PyroMark Assay Design version 2.0 (Qiagen, France). Target region of cytb gene with the insertion of nucleotides was amplified using the following program ...
-
Expansion of apical extracellular matrix underlies the morphogenesis of a recently evolved structurebioRxiv - Developmental Biology 2019Quote: ... was cloned using primers listed in key resources table using genomic DNA purified with the DNeasy Blood and Tissue Kit (QIAGEN). Primers were designed using sequence conservation with the GenePalette software tool (Rebeiz and Posakony 2004 ...
-
bioRxiv - Genomics 2019Quote: ... For the bacteria-specific 341F/805R47 primer pairs a different reaction mixture was used containing 10x Standard Taq Reaction buffer (Qiagen), 2 mM MgCl2 ...
-
bioRxiv - Molecular Biology 2019Quote: ... each of forward and reverse primers and 2 μl of nuclease-free water) was run in a Rotor-Gene Q thermal cycler (Qiagen) using 40 cycles of 95°C for 10 seconds ...
-
bioRxiv - Genetics 2020Quote: U8 DNA templates containing a T7 consensus sequence were PCR amplified from human or zebrafish genomic DNA (see Supplementary Table 2 for primer sequences) and purified after agarose gel electrophoresis using a QIAEX II kit (Qiagen). Human and zebrafish U8 snoRNAs were generated using 400-1000ng of template DNA and a mMESSAGE mMACHINE T7 kit (Life Technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... qPCR reactions were assembled for the gene of interest and a housekeeping gene (Gapdh) (see key resources table for the sequences of all primers used) using SYBR Green (QIAGEN). Reactions were run on a Rotogene qPCR machine (QIAGEN ...
-
bioRxiv - Cancer Biology 2022Quote: ... Remaining circular DNA was amplified by Multiple Displacement Amplification using φ29 DNA polymerase and random hexamer primers using the Qiagen REPLI-g Mini Kit (Qiagen). Magnetic bead-based purification was used to remove the polymerase and primers ...
-
bioRxiv - Microbiology 2022Quote: ... and trio (primers P7 and P8) were amplified from genomic DNA of G3 mosquitoes isolated with the Blood & Tissue Kit (Qiagen) as shown in File S1 ...
-
bioRxiv - Microbiology 2024Quote: ... amplification was carried out using a p5 indexing primer comprising the sequence AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC (where [i5] denotes the barcode sequence) and a P7 primer in combination with the HotStarTaq master mix kit from Qiagen. This process added unique barcodes as well as the necessary P5 and P7 flow cell adapter sites required for Illumina sequencing ...