Labshake search
Citations for Qiagen :
2851 - 2900 of 3116 citations for 1 2 Dihydro 1 2 tetrahydro 2H pyran 2 yl oxy ethyl 5H tetrazole 5 thione d4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: Ten millilitres of culture were pelleted by centrifugation (5,000 × g for 3 min at 4°C) and resuspended in 5 mL of RNAlater (76106; Qiagen). Samples were stored at 4°C overnight ...
-
bioRxiv - Genetics 2023Quote: ... medium was removed using the Bluewasher (BlueCatBio) and cells were lysed for 5 min using RLT plus buffer (Qiagen), snap frozen on dry ice and stored at −80 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... Hybridization was performed at 66 °C overnight with 40 nM 5′ TYE-563-labelled locked nucleic acid (LNA)-(C4G2)2.5 probe (Exiqon Qiagen). Cells were then washed once in 2X SSC/0.1% Tween-20 for 5 minutes and three times in 0.1X SSC for 10 minutes at RT before being dehydrated as above and nuclei stained with DAPI.
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR mix contained 0.16 µM of each of the fluorescent universal primer and of the reverse specified primer and 0.04 µM of the 5’ tail forward primer in a final 15 µl reaction volume (2x QIAGEN Multiplex PCR Master Mix with 3 mM Mg2+ ...
-
bioRxiv - Biochemistry 2024Quote: ... The lysate was pelleted by centrifugation at 30,000 x g for 30 min and the supernatant was mixed with 5 mL Ni-NTA resin (Qiagen) pre-equilibrated with lysis buffer in a 50 mL falcon tube ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was filtered through a 0.45 µm syringe filter and applied to a 5 ml Ni-NTA agarose column (Qiagen) pre-equilibrated in Lysis-Wash buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... Supernatants were filtered through a 0.22 µm syringe filter before application to 5 ml of nickel resin (Ni-NTA Superflow, QIAGEN) equilibrated in loading buffer (25 mM HEPES-KOH pH 7.6 ...
-
bioRxiv - Neuroscience 2023Quote: ... The filtrated supernatant containing His-thioredoxin-ApoE was applied to a 5 ml Ni-NTA Superflow Cartridge (Qiagen, Germany) pre-equilibrated with TBS buffer A ...
-
bioRxiv - Plant Biology 2023Quote: ... and 20 ng cDNA were subjected to the Rotor-Gene Q 5-Plex HRM real-time PCR system (Qiagen), using the default program ...
-
bioRxiv - Biochemistry 2023Quote: ... Lysates were clarified by centrifugation at 24,000 g for 30 min and applied to a 5 mL column bed of Ni-NTA resin (Qiagen) for purification by IMAC ...
-
bioRxiv - Biochemistry 2023Quote: ... The sonicate was centrifuged at 38,000 × g for 30 min and the supernatant was loaded on a Ni-NTA agarose column (2.5 × 5 cm, Qiagen) pre-equilibrated with buffer (50 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2023Quote: ... The kidneys were homogenized using 0.5 M acetic acid and two 5-mm steel beads in TissueLyser LT (Qiagen), followed by addition of pepsin to 0.1 mg/ml and incubation for 3 days ...
-
bioRxiv - Genomics 2023Quote: ... VDAC1P8-201 and GAPDH (Suppl. Table 5) and 12.5 μl of master mix (QuantiFast SYBR Green PCR kit, Qiagen). Analysis of relative expression level was performed using the housekeeping GAPDH gene as internal calibrator by the ΔΔCt method ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA from approximately 25-50 EBs at day 5 of differentiation was isolated using RNeasy Mini kit (Qiagen) and quantified by NanoDrop (Thermo Fisher) ...
-
bioRxiv - Microbiology 2023Quote: ... The cells were then incubated in lysis buffer (DPBS with 0.5% Triton X-100, 10 mM MgCl2, 5 mM CaCl2, 100 µg/mL RNAse A (Qiagen)) overnight at 37°C in a water bath to allow capsid maturation ...
-
bioRxiv - Microbiology 2023Quote: ... Lysate was centrifuged (6000rcf, 5 minutes) and genomic DNA (gDNA) extracted from pellets also using the DNeasy kit (QIAGEN). Successful gene modification events or maintenance of the wildtype loci was performed by PCR using primers listed in Table S5.
-
bioRxiv - Cell Biology 2023Quote: ... The supernatant was 0.2 µM filtered and was incubated overnight at 4°C with 5 mL of Ni-NTA beads (Qiagen). XXX
-
bioRxiv - Cell Biology 2023Quote: Genomic DNA was extracted from 5-10×106 cells using the Gentra Puregene Cell Kit (Qiagen, cat no. 158046) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... qPCR reactions were set up in duplicate in the Rotor-Gene Q thermocycler 5 plex (Qiagen, Germantown, MD, USA). Primers reported here were designed using Primer BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/ ...
-
bioRxiv - Biophysics 2023Quote: ... Transformants were grown to saturation in 5-8mL of LB media supplemented with ampicillin (100µg/mL) and miniprepped (Qiagen) for Sanger sequencing ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell lysates were clarified by centrifugation at 20,000 x g for 30 min and loaded on a 5 ml Ni-NTA Superflow column (QIAGEN) followed by extensive washing ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA and RNA from healthy tissues and lymphomas of control and STIL-transgenic mice was extracted using the All Prep DNA/RNA/Protein Mini Kit according to manufacturer’s instructions after tissue homogenization using TissueLyser II and stainless-steel beads (5 mm, all Qiagen). DNA and RNA concentrations were quantified with Qubit 2.0 using the dsDNA High Sensitivity and RNA High Sensitivity Kit (both Thermo Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... The filtrated supernatant containing His-tagged NanoLuc was applied to a 5-mL Ni-NTA Superflow Cartridge (Qiagen, Germany) pre-equilibrated with TBS buffer A ...
-
bioRxiv - Cancer Biology 2024Quote: ... was run on an Applied Biosystems Quant Studio 5 machine using RT2 SYBR Green ROX Mastermix (catalog: 330521; Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells transfected with dsRNA were harvested after 5 days and RNA was extracted using the RNeasy Micro Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The cells were then incubated in lysis buffer (DPBS with 0.5% Triton X-100, 10 mM MgCl2, 5 mM CaCl2, 100 µg/mL RNAse A (Qiagen)) overnight at 37°C in a water bath to allow capsid maturation ...
-
bioRxiv - Genetics 2024Quote: Total mRNA was isolated from 6 hpf to 5 dpf zebrafish homogenates using an RNeasy Mini Kit (Qiagen, 74106) and reverse-transcribed with iScript (Bio Rad ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was collected and filtered through a 0.2 μm asymmetric polyethersulfone membrane and applied to a 5 mL Ni-NTA Superflow cartridge (QIAGEN). The His- tagged SsdA protein was eluted with a linear concentration gradient of imidazole and further purified by size-exclusion chromatography (SEC ...
-
bioRxiv - Cell Biology 2024Quote: ... qPCR reactions for genes of interest were performed on a QIAquant 96 well 5 plex qPCR machine (Qiagen, 9003010). Using PrimeTime qPCR probe assays (IDT ...
-
bioRxiv - Biochemistry 2024Quote: ... Lysates were clarified by centrifugation at 30,000 g for 30 min and applied to a 5 mL column bed of Ni-NTA resin (Qiagen) for purification by IMAC ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA was extracted from HAEC and HCAEC (from passages 4-5) using RNeasy Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... we first isolated RNA from S2R+ cells (1×107 for the control and KD cells) according to the manufacturer’s protocol (Qiagen RNeas Mini Kit Cat No./ID: 74104). We used 500 ng of isolated RNA for cDNA synthesis ...
-
bioRxiv - Molecular Biology 2020Quote: DNA was extracted from each sample type using three different approaches: 1) Qiagen (QIAamp® DNA minikit or QIAamp® DNA Stool Mini Kit, Qiagen Inc., Germantown, MD, USA); 2 ...
-
bioRxiv - Cell Biology 2024Quote: ... were incubated in a 50 µL reaction with or without triton-x (1% v/v) and with or without proteinase K (Qiagen #19131, final concentration 20 µg/mL) for 15 minutes at room temperature ...
-
bioRxiv - Plant Biology 2020Quote: Quantitative real-time PCR was performed in a volume of 5 mL QuantiTect Probe PCR Kit (Qiagen GmbH, Hilden, Germany) kit and an ABI 7900HT fast real-time PCR system (ThermoFisher Scientific Inc. ...
-
bioRxiv - Biophysics 2021Quote: ... The supernatant was collected and subjected to affinity purification using 5 mL Hi-Trap column containing Ni-NTA resin (Qiagen) on an AKTA Pure 25L protein purification system (GE Healthcare) ...
-
bioRxiv - Biochemistry 2021Quote: ... and cDNA products containing the R2R adapter attached to their 5′ end were cleaned-up by using a MinElute column (Qiagen) to remove unused primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Genetics 2021Quote: ... and E11 (5’-AGGAAAAAGGAAATAAATTA-3’) primers on pDH373 as a template generated a smaller fragment that was cleaned up by QIAGEN MinElute PCR Purification Kit (#28004) ...
-
bioRxiv - Genetics 2021Quote: Pools of 5 mites were ground to powder in liquid nitrogen and total RNA was extracted using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2021Quote: ... E18.5 RNA was extracted from cortices of 3 genotypic conditional knockouts and 4 controls using the RNeasy Micro Kit (Qiagen). RNA was reverse transcribed to cDNA using the SuperScript™ II Reverse Transcriptase Kit (Invitrogen) ...
-
bioRxiv - Molecular Biology 2021Quote: Cells were transfected at 60-80% confluence with 5 nM/1nM (MIN6, EndoCβ-H1, respectively) control or miR-125b mimics (Qiagen) or 50 nM of a mixture of four ONTARGETplus siRNAs against mouse Smad2 ...
-
bioRxiv - Biochemistry 2021Quote: ... The RNA was prepared from 5 OD equivalents of stressed and unstressed cells using the RNeasy Plus RNA Isolation Kit (Qiagen). 500 ng RNA of the total isolated RNA were used as a template for the synthesis of cDNA using Oligo(dT ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were then aspirated using a freshly flame-pulled patch pipette (2.5 inner diameter) and placed into a 5 μl of lysis Buffer TCL (Qiagen, 1031576) + 1% 2-mercaptoethanol (Millipore-Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... LRRCC1-si2 (target sequence: 5’- TTA GAT GAC CAA ATT CTA CAA - 3’) and control siRNA (AllStars Negative Control) were purchased from Qiagen. siRNAs were delivered into cells using Lipofectamine RNAiMAX diluted in OptiMEM medium (ThermoFisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from frozen mouse liver (20-25 mg) and HepG2 cells (5-6 million) using the AllPrep DNA/RNA Mini Kit (QIAGEN) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... and template-switching oligo (5′-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3′, where “r” indicates a ribonucleic acid base and “+” indicates a locked nucleic acid base; Qiagen). cDNA was amplified using KAPA HiFi HotStart ReadyMix kit (Roche #KK2502 ...
-
bioRxiv - Cancer Biology 2020Quote: DNA and RNA were extracted from the cervical cancer tissues (5-10 mg) using the AllPrep DNA/RNA Micro Kit (QIAGEN) as described by the manufacturer ...
-
bioRxiv - Bioengineering 2020Quote: ... 100 ng equivalent of pooled total RNA (5 slices per animal; 7 rats) was used to synthesize cDNA using an RT First Strand Kit (Qiagen). Pre-validated primers targeting rat CXCR4 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The entire flies were mechanically crushed for 30 s at 25 Hz using a 5-mm stainless steel bead in a TissueLyser (Qiagen). Three hundred μL of ACL solution and 20 μL of 16 g.L-1 proteinase K were then added to the samples ...