Labshake search
Citations for Qiagen :
2751 - 2800 of 3116 citations for 1 2 Dihydro 1 2 tetrahydro 2H pyran 2 yl oxy ethyl 5H tetrazole 5 thione d4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... at 300 cells per well into 96 well LoBind plates containing 5 μL of EB buffer (Qiagen). After sorting ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatant was passed through a 5 mL column volume (CV) of Ni-NTA agarose resin (Qiagen: 30250). The column was then washed with 10 CV of His binding buffer (50 mM NaH2PO4 ...
-
bioRxiv - Neuroscience 2024Quote: ... The pellet was resuspended in 340μl of lysis buffer containing 5 mM EDTA and proteinase K (Qiagen) and incubated at 55°C overnight ...
-
bioRxiv - Bioengineering 2024Quote: ... Tsg101 (Hs_TSG101_6) target sequence: 5′-CAG TTT ATC ATT CAA GTG TAA -3′ (QIAGEN, cat. no. SI02655184); Alix (Hs_PDCD6IP_5 ...
-
bioRxiv - Bioengineering 2024Quote: ... Alix (Hs_PDCD6IP_5) target sequence: 5′-AAG AGC TGT GTG TTG TTC AAT -3′ (QIAGEN, cat. no. SI02655345); Negative Control siRNA ...
-
bioRxiv - Microbiology 2024Quote: ... NGS libraries were constructed using Enzymatics 5× WGS fragmentation mix and WGS ligase reagents (Qiagen, Hilden, Germany), and then libraries were sequenced on HiSeq X Five platform in Macrogen Japan (Tokyo ...
-
bioRxiv - Immunology 2024Quote: RNA was extracted from 5 × 106 T cells using the RNeasy® Mini Kit (Qiagen, Cat. 74106). RNA extraction was performed following the instructions from the “Purification of Total RNA from Animal Cells Using Spin Technology” protocol given in the RNeasy® Mini Handbook ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 mm punch biopsies were excised from trunk nodules and immersed in 2.5 ml RNALater Reagent (Qiagen). Incisions were treated with iodine and oxytetracycline ...
-
bioRxiv - Molecular Biology 2024Quote: Total RNAs were extracted from 5×105 cultured cells using an RNA isolation kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
Microbial iCLIP2: Enhanced mapping of RNA-Protein interaction by promoting protein and RNA stabilitybioRxiv - Molecular Biology 2024Quote: ... one steel bead (5 mm diameter) was added and placed into a pre-cooled TissueLyser Adapter (Qiagen). The samples underwent two rounds of cell lysis ...
-
bioRxiv - Immunology 2024Quote: ... The digested mixture was then loaded onto a pre-equilibrated 5 mL Ni-NTA Superflow column (Qiagen) to remove the cleaved His-tag ...
-
bioRxiv - Bioengineering 2024Quote: ... Gibco) with 5% (w/v) glucose (Fisher ChemicalTM) pH 7.4 and nuclease-free water (NF water, Qiagen). Then ...
-
bioRxiv - Genomics 2021Quote: ... These leftover materials were collected by LCM and placed into 350 μl of RLT lysis buffer (RNeasy, Qiagen, including 1%β-Mercaptoethanol (β-Me)) followed by RNA extraction and examination with the 2100 Bioanalyzer.
-
bioRxiv - Plant Biology 2020Quote: ... Frozen cells were disrupted by bead beating at 30 h/z for 1 min before purifying total RNA using an RNeasy® plant mini kit (Qiagen™; ref. 74904) according to manufacturer’s instructions ...
-
bioRxiv - Physiology 2020Quote: ... Samples were subjected to dry pulverization before being homogenized in buffer (350 μL of Qiagen RLT buffer with 1% β-mercaptoethanol; Qiagen, Germantown, MD, USA). The homogenate was transferred to an RNase-free 1.5 mL centrifuge tube ...
-
bioRxiv - Cancer Biology 2022Quote: ... The lysate was cleared by centrifugation (35,000 x g, 1 h) and the supernatant was loaded onto a Ni-affinity chromatography column (Qiagen Ni-NTA Superflow, 20 mL) pre-equilibrated with Ni-NTA buffer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... we ran the digest products on 1% Tris-acetate EDTA gels and extracted and purified the correctly sized products (Qiagen QIAQuick Gel Extraction Kit). In parallel ...
-
bioRxiv - Physiology 2023Quote: RNA was extracted from MLEC and lung tissue by lysis in RLT buffer containing 1% β-mercaptoethanol for RNA isolation and subsequently purified using the RNeasy Mini Kit (Qiagen, 74106, Hilden, Germany) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... Quantification of the relative miRNAs’ expression level was detected by specific miRCURY LNA miRNA PCR Assays and highly sensitive miRCURY LNA SYBR® Green PCR Kit while adjusting the reverse transcriptase product dilution to 1:30 (QIAGEN, Cat. No. 339345). The calculation of relative miRNA expression was based on the -ΔΔCT method ...
-
bioRxiv - Synthetic Biology 2024Quote: Total RNA was extracted from frozen pellets of approximately 1×106 cells per condition using RNeasy Plus Micro Kit (Qiagen, Redwood City, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... LF/LF = 5 mice from two cages over two experiments) using the DNeasy PowerSoil Kit (Qiagen, Germantown, MD). Modifications to the standard protocol included a 10-minute incubation at 65°C immediately following the addition of the lysis buffer and the use of a bead mill homogenizer at 4.5 m/s for 1 min ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA-Seq libraries were prepared from 5 ng total RNA using the NEB Next RNA Ultra Kit (QIAGEN) with poly(A ...
-
bioRxiv - Immunology 2021Quote: ... and probe (375 nM, 5’-6FAM-ACACTAGCC/ZEN/ATCCTTACTGCGCTTCG-IABkFQ-3’) with 12.5μL of 2X QuantiFast Probe Mix (QIAGEN), 0.25μL of 2X QuantiFast RT Mix (QIAGEN) ...
-
bioRxiv - Microbiology 2021Quote: ... 20 mM imidazole was added to the supernatant and incubated with 5 mL of Ni-NTA resin (Qiagen) with a stirring magnet at 4°C for 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... Protein lysates were separated on NuPage 5-12% Bis-Tris or 3-8% Tris-Acetate gels (Novex, Qiagen) using MES running buffer (Novex ...
-
bioRxiv - Immunology 2022Quote: ... and 5 cells per well were sorted into a 96-well plate containing TCL buffer (Qiagen, cat. 1031576) with 1 % beta- Mercaptethanol and snap frozen on dry ice ...
-
bioRxiv - Biophysics 2022Quote: ... The suspension was spun down at 16,000 r.c.f at 4 °C for 30 min and the supernatant was applied 5 ml Ni-NTA resin (Qiagen)/ L culture medium ...
-
bioRxiv - Immunology 2022Quote: RNA was extracted from CTLs (days 0, 5 and 7) using the RNeasy Plus Mini Kit (Qiagen. #74136), reverse transcribed to first-strand cDNAs using iScript™ cDNA Synthesis Kit (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: ... total DNA from 5 × 105 J-Lat cells was purified using Qiagen blood mini kit (Qiagen, Hilden, Germany) and quantitated spectrophotometrically ...
-
bioRxiv - Cell Biology 2020Quote: ... total RNA was isolated from 5 × 105 cells with the AllPrep© DNA/RNA/Protein Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA for expression analyses was extracted from 5 day-old protonemata using a RNeasy Plant Mini Kit (Qiagen). Genomic DNA removal and cDNA synthesis were performed with a Quantitect Reverse Transcription kit (Qiagen).
-
bioRxiv - Developmental Biology 2021Quote: Log fold-change values of the top 5% proteins were used as input for Ingenuity Pathway Analysis (Qiagen: https://digitalinsights.qiagen.com/products/features/) ...
-
bioRxiv - Cancer Biology 2021Quote: RNA was extracted from 5×106 cells per sample using the AllPrep DNA/RNA/miRNA Universal Kit (QIAGEN) according to manufacturer’s recommendations with additional DNase I treatment for RNA extraction ...
-
bioRxiv - Developmental Biology 2022Quote: ... Complementary DNA of microRNAs was synthesized from 5 μg total RNA using microRNA-specific primers (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Genomic DNA was eluted from the column using 5 mL of prewarmed (50°C) QF Buffer (Qiagen, Germany). DNA was precipitated by adding 0.7 volumes of isopropanol ...
-
bioRxiv - Microbiology 2022Quote: DNA was extracted from the Sterivex filters (i.e., 0.22–5 μm size fraction) using an AllPrep DNA/RNA Mini Kit (80204; Qiagen) with a modified protocol ...
-
bioRxiv - Microbiology 2022Quote: RNA was extracted from 5-10 snap-frozen larvae with the RNeasy Mini kit (Qiagen cat no. 74104) and reverse-transcribed using QuantiTect Reverse Transcription kit (Qiagen cat no 205311 ...
-
bioRxiv - Immunology 2022Quote: Total RNA from ~ 5 × 105 neutrophils (CD45+Lin-CD11b+Ly6G+) was isolated with the RNeasy micro kit (Qiagen) and RNA quality was checked with the Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmid DNA was extracted from 5 mL of this culture using the QIAprep Spin Miniprep Kit (Qiagen, 27104). Glycerol was added to the remaining culture to a final concentration of 15% (v/v ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmid DNA was extracted from 5 mL of this culture using the QIAprep Spin Miniprep Kit (Qiagen, 27104). The remaining 95 mL of culture was combined with 40.7 mL 50% glycerol (v/v) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were eluted using an imidazole gradient and subsequently loaded onto a 5 ml StrepTactin Superflow Cartridge (Qiagen) at a flow rate of 0.8 ml/min ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR amplification was carried out in 5 µl reactions using the QIAGEN Multiplex PCR Kit (QIAGEN, Germany). Each sample reaction contained 10–20 ng of genomic template DNA ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... A 5 ml aliquot of culture was removed and added to 10 ml of RNAprotect Bacteria Reagent (Qiagen) and mixed by vortexing ...
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Microbiology 2023Quote: ... Edmund Bühler) by bead beating twice for 5 min at 30 Hz in a Tissue Lyzer II (QIAGEN). Lysates were then incubated for 30 min at 37 °C with shaking ...
-
bioRxiv - Plant Biology 2023Quote: Total RNA from 5-day-old whole plants was extracted using the RNeasy Plant Mini Kit (Qiagen, 74904). For RNA-seq ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from 5-10 g of soil per sample with the DNeasy PowerMax Soil Kit (Qiagen) and used for short read and long read sequencing ...
-
bioRxiv - Physiology 2023Quote: ... a 5 mg piece of kidney tissue was homogenized in 350 μL of RNeasy RLT Lysis buffer (Qiagen) containing 2-mercaptoethanol and centrifuged at maximum speed for 3 minutes at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... Sequences with an E-value lower than 1e-5 were used for multiple sequence alignment using CLC v 21.0.5 sequence manager (Qiagen). After multiple rounds of alignments and manual removing non-nAChR sequences a set of 2047 proteins were obtained ...