Labshake search
Citations for Qiagen :
2601 - 2650 of 3116 citations for 1 2 Dihydro 1 2 tetrahydro 2H pyran 2 yl oxy ethyl 5H tetrazole 5 thione d4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: Reverse transcription was performed on 5 μl of RNA suspension using QuantiTect Reverse Transcription kit (Qiagen) with either the qiagen RT primer mix or the SgleadSARSCoV2-F primer (for negative strand viral transcripts ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was isolated from adult (5-week-old) plants using an RNeasy plant kit (Qiagen), treated with a TURBO DNA-free kit (Ambion) ...
-
bioRxiv - Cancer Biology 2020Quote: ... AAVS1 +161 bp Reverse 5’ GAGGTTCTGGCAAGGAGAGA) and purified using the PCR clean up kit (Qiagen, MD). Amplicons were sequenced by MiSeq (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... was added to the tube together with a 5 mm stainless steel bead (Qiagen, Maryland, USA). The sample was homogenized for two minutes at 30 Hz using a TissueLyser II (Qiagen ...
-
bioRxiv - Developmental Biology 2020Quote: ... small RNA-enriched total RNA was treated twice with 5 μl of RNase-free DNase (Qiagen) for 45 minutes at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted from 5×106 human PBMCs from Cohort II using AllPrep RNEasy kits (Qiagen) and the small RNA-containing column flow-through collected ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 male C57Bl/6 mice-derived pial tissue was extracted using RNeasy Micro Kit (Qiagen, #74034). After RiboGreen quantification and quality control by Agilent BioAnalyzer ...
-
bioRxiv - Microbiology 2021Quote: ... sorokiniana were ground with two stainless steel beads (5 mm) using a TissueLyser (Qiagen, Hilden, Germany) at 30 Hz for 1 minute at room temperature and soaked in 1 ml of 100 mM sodium acetate buffer pH 5.0 at 70°C overnight ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 50 mM Tris pH 8.0) using 5 mM stainless steel beads in a TissueLyser II (Qiagen). In vitro TPP1 assay was performed as described ...
-
bioRxiv - Biochemistry 2020Quote: ... and pJET_Luc_FL_UTR_REV (5’-GCAATGAAAATAAATGTTTTTTATTAGGCAGAATCCAAATGC-3’) primers and was purified with the QIAquick PCR Purification Kit (Qiagen) directly after the PCR reaction ...
-
bioRxiv - Biochemistry 2021Quote: ... The clarified lysate was applied to two tandemly-connected 5 ml Ni-NTA Superflow cartridges (Qiagen); the cartridges were washed with buffer containing 20 mM Tris pH 8.0 ...
-
bioRxiv - Cancer Biology 2021Quote: ... sections were incubated in 0.08 M KOH for 5 min and washed by Buffer EB (Qiagen). Then ...
-
bioRxiv - Microbiology 2020Quote: ... The proteolysis reaction products were then passed over a 5 mL Ni-NTA superflow cartridge (Qiagen) to remove TEV and uncleaved protein ...
-
bioRxiv - Genomics 2020Quote: ... before aliquoting into 5 tubes and proceeding with the Qiagen DNeasy Plant Mini Kit (Qiagen; 69104) protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2.8□l of forward and reverse primer at 5□M concentration and 10□l QuantiNova (Qiagen), made up to a final volume of 20□l with nuclease-free water ...
-
bioRxiv - Microbiology 2024Quote: ... One µg of purified RNA was treated twice with 5 µl of RNAse-free DNAse (Qiagen) and subjected to a final on column purification ...
-
bioRxiv - Microbiology 2024Quote: ... DNA was prepared from approximately 5×106 cells using the DNeasy-96 kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μL of each reaction mixture was used for amplification with the REPLI-g kit (Qiagen) at 16 °C overnight and cleaned with the DNA Clean & Concentrator kit to yield samples for sequencing ...
-
bioRxiv - Biophysics 2022Quote: ... to dephosphorylate 5’ ends.Digested inserts were gel extracted using the QiaQuick gel extraction kit (Qiagen, Germany). Digested and 5’ dephosphorylated vector was purified using the QiaQuick PCR Cleanup kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... A Locked Nucleic Acid (LNA) probe was used to detect centromere regions (5’-TTGGCTACACCATGAAAGCTT-3’; Qiagen). 20 μL of probe mix (250 nM LNA probe ...
-
bioRxiv - Developmental Biology 2022Quote: ... total RNA from 5 embryos was extracted using the RNeasy microRNA isolation kit (Qiagen, Valencia, CA), and the RNA samples were digested on-column with RNase-free DNase I to eliminate genomic DNA ...
-
bioRxiv - Genomics 2022Quote: We extracted RNA from 5 × 105 cells using the QIAGEN RNeasy Mini kit (Qiagen, cat # 74014) with DNase I treatment (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... Each reaction contained 5 μL DNA solution and PCR mixture with Taq Type-it (Qiagen®). PCR products were analyzed by capillarity electrophoresis on an ABl3130xl sequencer ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The obtained 5□- and 3□-RACE products were purified using a QIAquick Gel Extraction Kit (QIAGEN), subcloned into a pTAC-2 Vector (Bio Dynamics Laboratory lnc. ...
-
bioRxiv - Microbiology 2024Quote: ... cell pellets were resuspended in lysis buffer (250 μL 1X PBS + 5 μL lytic enzyme (Qiagen) per sample ...
-
bioRxiv - Microbiology 2024Quote: ... and homogenized by bead-beating with 3 x 5 mm stainless steel beads (Qiagen, Hilden, Germany) in 1 ml sterile 1X PBS to produce internal fly-bacterial suspensions.
-
bioRxiv - Microbiology 2024Quote: ... cell pellets were resuspended in lysis buffer (250 μL 1X PBS + 5 μL lytic enzyme (Qiagen) per sample ...
-
bioRxiv - Microbiology 2024Quote: 3-5 × 105 cells were harvested and total RNA was extracted using the RNeasy kit (Qiagen) employing on-column DNase treatment ...
-
bioRxiv - Immunology 2024Quote: ... 5-10×103 cells from each population were sorted into tubes containing 300μl RLT buffer (Qiagen) with β-mercaptoethanol (BME) ...
-
bioRxiv - Genomics 2024Quote: ... 100 mg of frozen needles were cut into < 5 mm pieces and disrupted using TissueLyser (Qiagen) at 30 1/s for 2×120 s ...
-
bioRxiv - Microbiology 2024Quote: ... left still for 5 min and transferred to a RNeasy spin column (RNeasy Mini kit, QIAGEN). The column was washed two times with RPE buffer before elution in RNA-free water ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 ml of cell lysate was used for silica enrichment using RNeasy Maxi Kit (Qiagen, 75162) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... with 5% DMSO as an additive then amplicons were purified with a PCR cleanup kit (Qiagen). In vitro transcription reactions were set up in a volume of 320 µl with 8 µg PCR product template DNA ...
-
bioRxiv - Genomics 2024Quote: ... Pure plasmid was isolated from 5 mL cultures using Qiaprep Spin Miniprep Kit (Qiagen, catalog # 27106) and sequences were confirmed by whole plasmid sequencing with Primordium Labs ...
-
bioRxiv - Bioengineering 2024Quote: ... We dilute the amplified DNA sample with 5 additional volumes of PB buffer (Qiagen cat# 19066) and load it onto a QIAquick tube ...
-
bioRxiv - Genomics 2021Quote: ... was run in a 1% agarose gel and the desired band (1.8 kb) was purified using QIAquick gel extraction kit (Qiagen, Cat. No. 28704) and used as a template for the transcription reaction ...
-
bioRxiv - Microbiology 2021Quote: RNA was extracted from the supernatant of cells infected with Candid #1 (P0 and P11) using the QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... was induced by adding isopropyl β-D-1-thiogalactopyranoside (IPTG) into the LB media and purified by Ni-NTA affinity chromatography (Qiagen, USA). The full length of ASSCP2 protein (ASSCP2-R ...
-
bioRxiv - Developmental Biology 2020Quote: ... Japan) and 1 μL of the cDNA synthesis reaction mixture was used with the Platinum SYBR Green kit from Qiagen (Hilden, Germany). q-PCR was performed using a Rotor-Gene Q Real-time PCR machine (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: PCR with forward and reverse primers (see Table 1) was performed on mouse hypothalamic cDNA (isolated with miRNeasy Mini Kit, Qiagen, Hilden, Germany). PCR products were ligated into pGEMT.easy (Promega ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... PCR products were resolved on a 1% w/v agarose gel and purified using a QIAquick Gel Extraction kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... and damaged OA cartilage with a Mankin score of 4 or higher (n=1, female, 80 years old) using MiRNeasy Kit (Qiagen, Germantown, USA). RNA was quantified using the Nanodrop 1000 Spectrophotometer (Thermo Fisher ...
-
bioRxiv - Zoology 2020Quote: Adult Spadella cephaloptera were starved for three days and sacrificed together with developmental stages covering early zygotes to hatched 1 months old juveniles for RNA extraction by using a RNA extraction kit (Qiagen, Roermond, Netherlands). Additional adults and developmental stages were carefully anesthetized in 7.14% MgCl2 before fixation and fixed for 1 hour at room temperature for in situ hybridization experiments and treated as previously described (Wollesen et al ...
-
bioRxiv - Bioengineering 2021Quote: ... Membranes were blocked with 5% milk in PBST (Phosphate buffer saline, 0.05% Tween 20) and incubated with monoclonal mouse anti-His antibody (Penta His, Qiagen, dilution 1:1000) according to the manufacturers’ instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were fixed at indicated time points after warming and then processed for immuno-identification of HPK using an antibody that recognizes the polyhistidine tag (RGS-His antibody; Qiagen 1:100) and counterstained for nuclei using DAPI ...
-
bioRxiv - Biochemistry 2020Quote: ... A final 370,000 x g centrifugation at 4°C for 45 min yielded a myosin-containing supernatant that was loaded onto a 1 mL nickel-nitrilotriacetic acid agarose (Ni-NTA) (Qiagen, Cat# 30210) column equilibrated with column buffer (50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Microbiology 2020Quote: ... Compost was crushed using mortar and pestle under liquid nitrogen and ground to a fine powder for 1 min at 30 Hz using a tissuelyser II with a steel grinding jar pre-cooled with liquid nitrogen (Qiagen, Venlo, Netherlands). RNA was extracted using a modified method described by Patyshakuliyeva et al ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA of strains IMX2300 and IMX2300-1 was isolated with a Blood & Cell Culture DNA Kit with 100/G Genomics-tips (QIAGEN, Hilden, Germany) according to the manufacturers’ instructions ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNA was extracted from cells treated for 48 h with 1 mM aspirin and 4 μM regorafenib using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen Cat# 80004) as per manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... DNA was resuspended in 30 μL of mQ water and incubated with 1 μL of RNase (10 mg/mL prepared from a stock of 100 mg/mL of RNase A from Qiagen, Darmstadt, Germany) at 37 °C for 1 h ...