Labshake search
Citations for Qiagen :
2551 - 2600 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: Pre-designed small interfering RNAs (siRNAs) and the non-target control (negative control) AllstarNeg were from Qiagen. 2×104 HeLa cells were reverse transfected with 10 nM siRNA using Lipofectamine RNAiMax (Life Technologies ...
-
bioRxiv - Microbiology 2024Quote: RNA extraction was performed using RNeasy Kit (Qiagen) according to supplier’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA for some isolates was extracted using DNeasy Blood & Tissue Kit (Qiagen), according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... the DNA was purified using DNeasy Blood and Tissue kit (Qiagen) following the standard protocol ...
-
bioRxiv - Microbiology 2024Quote: ... mixed with 1 mL phenol:chloroform:isoamyl alcohol (25:24:1 at pH 8) at 70°C for 12 min and bead beating for 2 min (Tissue Lyser II, Qiagen). The mixture was centrifuged at 4°C for 3 min at maximum speed and the aqueous phase was transferred to a new reaction tube ...
-
bioRxiv - Microbiology 2024Quote: ... PLY432 genomic DNA was extracted using the DNeasy Blood and Tissue Kit (Qiagen). The V4-V5 region of the 18S rRNA gene was amplified from purified genomic DNA using the 18S universal primers (574F-CGGTAAYTCCAGCTCYAV and 1192R-CAGGTGAGTTTTCCCGTGTT ...
-
bioRxiv - Microbiology 2024Quote: Genomic DNA was extracted using the Qiasymphony DSP DNA Midi Kit on the Qiasymphony system (Qiagen, UK) to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Cell pellets were resuspended in 450 µl RLT buffer (QIAGEN, Hilden, Germany) with 1% β-mercaptoethanol ...
-
bioRxiv - Microbiology 2024Quote: Total RNA was extracted from 239 individual swab sample using the RNeasy Plus universal mini kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... respectively (Qiagen, Germany), following a modified version of the manufacturer’s instructions in the case of filters (Chiang and Inostroza ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids were purified with the QIAprep Spin Miniprep Kit (QIAGEN, Hilden, Germany).
-
bioRxiv - Microbiology 2024Quote: ... Plasmid DNA was extracted using QIAprep Spin Miniprep Kit (Qiagen, Germantown MD USA) and used to transform E ...
-
bioRxiv - Microbiology 2024Quote: ... Material was ruptured two times for 1 min at 30 Hz in a TissueLyser (Qiagen Inc., Germantown, MD, USA). Between and after these two steps of tissue disruption ...
-
bioRxiv - Microbiology 2024Quote: ... Fungal DNA was extracted using a Qiacube robot with the DNeasy Plant Pro Kit 69206 (Qiagen).
-
bioRxiv - Microbiology 2024Quote: ... qPCR analysis of BICD1 and BICD2 expression Total RNA was extracted from GFP-ScaCMTS cells using the RNeasy RNA extraction kit (Qiagen) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were washed three times with PBS to eliminate unbound FVVs and RNAs were extracted using RNeasy plus mini kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... The purified RNA was ultimately resuspended in RNase-Free Water (QIAGEN), and its concentration was determined at 260 nm using a NanoDrop ND-1000 spectrophotometer ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was extracted using the RNeasy Mini Kit (Qiagen), and genomic DNA was removed using the TURBO DNA-free kit (Invitrogen) ...
-
bioRxiv - Microbiology 2024Quote: ... with the RNA protect Bacteria reagents (QIAGEN), following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: Genomic DNA extraction was carried out on 250 μl of fecal samples using the DNeasy PowerSoil Kit (QIAGEN, USA) according to the manufacturer’s protocol with a slight modification as previously described (Kumpitsch et al.) ...
-
bioRxiv - Microbiology 2024Quote: ... Assembly was performed with the CLC Genomics workbench v.20 (CLC Bio, Qiagen), including the Microbial Genomics Pro Suite module ...
-
bioRxiv - Microbiology 2024Quote: ... this was reverse transcribed to cDNA using the Quantitect Reverse Transcription Kit (Qiagen, Germany). To obtain a more complete library ...
-
bioRxiv - Microbiology 2024Quote: ... with the QuantiTect Multiplex PCR kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Parasite genomic DNA was purified from the blood of a transfer mouse using the Qiagen QIAamp DNA Blood Kit (Qiagen, Cat# 51106), and genotyping PCR was performed to assess integration into the target locus ...
-
bioRxiv - Microbiology 2024Quote: ... The cDNA copy number in a small aliquot of each sample was measured on a QIAcuity digital PCR (dPCR) system (Qiagen) using forward primer ACGTGGTGTTTATTACCCTGACA ...
-
bioRxiv - Microbiology 2024Quote: ... or QIAprep Spin Miniprep Kit (QIAGEN). For GFP2 and GFP4 vectors successfully cloned enhancer constructs were further isolated with ZymoPure II Maxiprep kit (Zymo research).
-
bioRxiv - Microbiology 2024Quote: ... the DNA was isolated with the EZ1 DNA Tissue kit on the BioRobot EZ1 robot (Qiagen, Hombrechtikon, Switzerland).
-
bioRxiv - Microbiology 2024Quote: ... DNA was extracted using the DNeasy Blood & Tissue Kit (Qiagen) and resuspended in 100 μl ...
-
bioRxiv - Microbiology 2024Quote: ... His-tag-affinity chromatography-purifcation was performed with a Ni-NTA agarose (Qiagen, Hilden, Germany) gravity flow column ...
-
bioRxiv - Microbiology 2024Quote: ... 24 and 44 hpi and DNA was extracted using DNAeasy blood and tissue kit (Qiagen). Genome copy number quantitation was done by quantitative polymerase chain reaction (qPCR ...
-
bioRxiv - Microbiology 2024Quote: Bacterial genomic DNA was extracted separately from caecal tissue (∼100 mg) and caecal contents (∼200 mg) using a QIAamp Fast DNA Stool Mini kit (QIAGEN, Valencia, CA, USA) following the manufacturer’s pathogen detection protocol ...
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA were purified following manufacturer instruction for Gram-positive bacteria (DNeasy Blood and Tissue – Qiagen) and sequenced (Illumina sequencing at Core facility or Eurofins Genomics) ...
-
bioRxiv - Microbiology 2024Quote: ... DNA extraction was performed utilizing commercial kits and following manufacturer’s protocol (Qiagen’s DNeasy 96 Blood & Tissue Kit, Qiagen). The amount and quality of extracted DNA was evaluated using PicoGreen fluorometer and NanoDrop spectrophotometer (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... Bacteria are harvested by centrifugation (5 minutes, 4°C) and washed with 1 ml cold PBS containing RNA stabilization reagents (RNAprotect, Qiagen) before flash freezing and storage at -80°C ...
-
bioRxiv - Microbiology 2024Quote: ... We performed PCR reactions using the Taq Polymerase Phusion® High-Fidelity PCR Master Mix with GC buffer and prepared them according to the manufacturer’s instructions (Qiagen, Hilder, Germany). PCR amplification steps involved an initial denaturing step for 30 sec at 98°C ...
-
bioRxiv - Microbiology 2024Quote: ... PCR products were purified using the QIAquick Gel Extraction Kit (Qiagen). Restriction enzymes and T4 DNA ligase were purchased from NEB ...
-
bioRxiv - Microbiology 2024Quote: Depletion of rRNA (FastSelect Bacterial, Qiagen), libraries construction (TruSeq Stranded mRNA ...
-
bioRxiv - Microbiology 2024Quote: ... DNA extraction was performed utilizing commercial kits and following manufacturer’s protocol (Qiagen’s DNeasy 96 Blood & Tissue Kit, Qiagen). The amount and quality of extracted DNA was evaluated using PicoGreen fluorometer and NanoDrop spectrophotometer (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA of isolated colony were purified from 7.5 ml of culture (DNeasy Blood and Tissue – Qiagen) with an additional step of cell lysis with microbeads (Precellys Evolution) ...
-
bioRxiv - Microbiology 2024Quote: ... coli using the QIAprep Spin Miniprep Kit (Qiagen). All plasmids made by PCR cloning were sequenced by Azenta ...
-
bioRxiv - Microbiology 2024Quote: ... The DNA-free RNA was concentrated by MinElute Cleanup kit (Qiagen). The rRNA depletion ...
-
bioRxiv - Microbiology 2024Quote: ... Ni-NTA slurry (Qiagen) (0.8 ml bed volume ...
-
bioRxiv - Microbiology 2024Quote: ... The QIAamp DNA Mini and Fast Cycling kits (QIAGEN, UK) were used for DNA extraction and PCR amplification ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was extracted using the RNeasy plus bacteria kit (Qiagen) according to manufacturer indications ...
-
Hepatitis B Virus genomes associate with cellular sites of DNA damage by inducing replication stressbioRxiv - Microbiology 2024Quote: ... precipitated in isopropanol and resuspended in 100 μL of Buffer EB (Qiagen). Inverse PCRs were performed on the BglII-NlaIII fragments on the HBV genome using with inverse PCR primers tgccttctgacttctttccttcagt and cagtagctccaaattctttataaggg ...
-
bioRxiv - Microbiology 2024Quote: ... RNA samples were prepared by using RNeasy Mini kits (Qiagen), followed by DNA depletion with Turbo DNase (Ambion ...
-
bioRxiv - Microbiology 2024Quote: Genomic DNA was extracted using DNeasy Blood & Tissue Kit (Qiagen) following manufacturer’s instructions for tissues with a slight modification ...
-
bioRxiv - Microbiology 2024Quote: DNA extraction was performed using the DNeasy PowerSoil Pro Kit (Qiagen, Toronto, Canada) according to kit protocols ...
-
bioRxiv - Microbiology 2024Quote: ... DNA was extracted using the DNeasy PowerSoil Pro Kit (Qiagen, Toronto, Canada) according to kit protocols ...
-
bioRxiv - Microbiology 2024Quote: ... followed by rotation of the adapter and ten additional minutes of bead beating using a TissueLyser II (QIAGEN; Cat. No. 85300) using a 2 ml Tube Holder Set (QIAGEN ...