Labshake search
Citations for Qiagen :
201 - 250 of 754 citations for Human ADH5 siRNA since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... and AllStars negative control siRNA 1027281 (Qiagen).
-
bioRxiv - Cancer Biology 2020Quote: ... siRNA was obtained from Qiagen (Hilden, Germany). Cell culture reagents and flasks were purchased from HiMedia (France ...
-
bioRxiv - Cell Biology 2023Quote: ... mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349, Qiagen), and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299 ...
-
bioRxiv - Cell Biology 2023Quote: ... uL11m siRNA 5’-AGGAAGGAGGTCACACCAATA-3’ (SI04135684, Qiagen), mL65 siRNA 5’CAAGCUAUGUAUCAAGGAUtt3’ (s21375 ...
-
bioRxiv - Cell Biology 2023Quote: ... uL16m siRNA: 5’ TACGGAGTTTACAGAAGGCAA-3’ (SI00648291, Qiagen) and Negative control siRNA (SI03650318 ...
-
bioRxiv - Cell Biology 2023Quote: ... MRPL45 siRNA: 5’-CTGGAGTATGTTGTATTCGAA-3’ (SI00649005, Qiagen), bL27m siRNA 5’CAGGCAGACGCCAAGGCATTA-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647, Qiagen), uL16m siRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Molecular Biology 2022Quote: ... siRNAs were purchased from Qiagen (Germantown, MD) or Thermo Fisher Scientific (Ambion ...
-
bioRxiv - Microbiology 2022Quote: ... we obtained FlexiTube GeneSolution siRNA sets (Qiagen), comprising four unique ...
-
bioRxiv - Cell Biology 2022Quote: ... Negative control siRNAs were from Qiagen (#1022076), and SQLE siRNAs from Horizon (#L-009646-00-0005 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The AllStars negative-control siRNA from Qiagen was used as control siRNA.
-
bioRxiv - Molecular Biology 2023Quote: ... The All-Star negative control siRNA (Qiagen) was used as a control ...
-
bioRxiv - Genetics 2023Quote: ... The AllStars Negative Control siRNA (1027281, QIAGEN) was used for NONsi.
-
bioRxiv - Cancer Biology 2023Quote: ... All the siRNAs were purchased from Qiagen. We used two pooled siRNAs for PARP-1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... as well as control siRNA (SI03650325, QIAGEN), were transfected into cells using HiPerFect Transfection Reagent (Cat ...
-
bioRxiv - Cancer Biology 2023Quote: ... or Negative Control siRNA (Cat# 1027310, Qiagen) were reverse-transfected using Lipofectamine RNAiMAX (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following siRNAs were used from QIAGEN: Scrambled siRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... bL31m siRNA 5’-CCAGGCTTATGCACGACTCTA-3’ (SI00649271, Qiagen), mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and SFPQ siRNA #2 (Qiagen Cat#SI05783876) at 40 nM using Lipofectamine RNAiMax transfection reagent (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... We used AllStars Negative Control siRNA (Qiagen) as the control nonsilencing siRNA (siCTR).
-
bioRxiv - Immunology 2021Quote: A549 cells were transfected with TMPRSS2 siRNA or control siRNA by using Effectene Transfection Reagent (Qiagen, Hilden, Germany, B00118) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... The siRNA library that contained 90 siRNA targeting 45 genes of interest was custom synthesized by Qiagen (Table S3).
-
bioRxiv - Genetics 2020Quote: ... and cells treated with transfection mix without siRNA (Wild type (WT)) or non-targeting control siRNA (scrambled (SCR)) (Qiagen catalog SI03650318 ...
-
bioRxiv - Cell Biology 2022Quote: ... Non-targeting siRNA controls contained 20 nM (for ATGL) or 40 nM (for cPLA2α) AllStars Negative Control siRNA (Qiagen). Transfection complexes were generated using 1 μL/well Lipofectamine RNAiMAX in 24-well plates ...
-
Enhancer Remodeling Promotes Tumor-Initiating Activity in NRF2-Activated Non-Small Cell Lung CancersbioRxiv - Cancer Biology 2020Quote: ... H460 and H2023 cells 48 hrs following transfection with control siRNA or NRF2 siRNA (cat. no. HSS107128 and HSS107130) using the RNeasy Mini Kit (Qiagen). Cells treated with the control siRNA were analyzed in biological duplicates ...
-
bioRxiv - Cell Biology 2023Quote: ... ULK2 (mixture of 4 siRNAs, GS9706), TBC1D14 (mixture of 4 siRNAs, GS57533) and non-targeting (NT, # 5091027310) were purchased from Qiagen.
-
bioRxiv - Molecular Biology 2023Quote: Primary monocytes were cultured in 24-well plates and then transfected with control non-targeting siRNA (Dharmacon) or siRNA targeting ERN1 (Dharmacon) using HiPerFect reagent (QIAGEN) following the instructions provided by the manufacturer ...
-
bioRxiv - Biochemistry 2023Quote: A kinome-wide siRNA library that contained 4 individually arrayed siRNA sequences in 384-well plates was purchased from Qiagen. The library consisted of known kinases and associated proteins ...
-
bioRxiv - Immunology 2023Quote: ... MRC-5/hTERT or A549 cells were reverse transfected with ON-TARGETplus siRNA SMARTpools (Horizon Discovery) or FlexiTube siRNA (Qiagen) using Lipofectamine RNAiMAX transfection reagent (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... HBEC5i cells with treated with either non-specific siRNA or Flvcr2 siRNA were harvested and kept in 1 mL TRI reagent (Qiagen).
-
bioRxiv - Cancer Biology 2024Quote: Cells were transfected with 20 nM siRNA (siTFE3 #sc-38507, siMITF (QIAGEN, custom siRNA sequence: AAAGCAGUACCUUUCUACCAC or siCTRL (QIAGEN # 1027281)) ...
-
bioRxiv - Cancer Biology 2021Quote: ... AllStars Hs Cell Death siRNA (Cat# 1027298, Qiagen) was used as a positive control for transfection efficiency ...
-
bioRxiv - Cancer Biology 2021Quote: siRNAs targeting xCT (SLC7A11) were obtained from Qiagen. Control siRNA (ON-TARGET plus nontargeting pool ...
-
bioRxiv - Cell Biology 2020Quote: ... The siRNAs targeting TLNRD1 were purchased from QIAGEN (siTLNRD1#6 ...
-
TSG101 Associates with PARP1 and is Essential for PARylation and DNA Damage-induced NF-κB ActivationbioRxiv - Molecular Biology 2021Quote: ... (AllStars Hs Cell Death Control siRNA from Qiagen), and siRNA against IKKγ ...
-
bioRxiv - Molecular Biology 2021Quote: ... or PTBP siRNAs (Qiagen cat# SI02649206 and SI04255146) using Lipofectamine RNAiMAX (Thermofisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... and FlexiTube siRNAs for Smg6 and Smg7 (Qiagen) were used ...
-
bioRxiv - Immunology 2021Quote: ... non-targeting control siRNA was from Qiagen (1027281).
-
bioRxiv - Cell Biology 2021Quote: ... The following siRNAs were used: AllStars (Qiagen; SI03650318), Grb2-targeting siRNA oligos GAAAGGAGCUUGCCACGGGUU and CGAAGAAUGUGAUCAGAACUU ...
-
bioRxiv - Cell Biology 2021Quote: ... SiRNAs were obtained from Qiagen (Supplemental Table S3). SiRNA forward transfections with Lipofectamine RNAiMAX (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: Cells were transfected with siRNA using HiPerfect (Qiagen). We used 20 nM KDM4A FlexiTube GeneSolution siRNA (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... An AllStars (AS) Negative Control scrambled siRNA (Qiagen) with no homology to any known mammalian gene was used as a negative control ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA against Nup50 (SI00663236) was obtained from Qiagen. The siRNA against mouse Nup50 (156930 ...
-
bioRxiv - Cell Biology 2021Quote: ... Allstars Negative Control siRNA (Qiagen, Venlo, The Netherlands) was used as the negative control (siCTL) ...
-
bioRxiv - Cell Biology 2020Quote: ... and AllStars negative control siRNA (Qiagen cat# 1027281). siRNAs were delivered into cells using Lipofectamine RNAiMAX (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... siRNAs were transfected using the HiPerfect reagent (Qiagen) into primary human monocyte-derived macrophages 72 h before or into THP-1 cells 48 h before experimental assays ...
-
bioRxiv - Physiology 2022Quote: ... Allstars Negative Control siRNA (Qiagen, Venlo, the Netherlands) was used as a negative control (siCTRL) ...
-
bioRxiv - Developmental Biology 2022Quote: ... or Setd3 siRNAs (Qiagen 1027416, Gene ID: 52690) were injected at 2.5 μM.
-
bioRxiv - Microbiology 2020Quote: ... AllStars negative control siRNA was purchased from Qiagen. siRNAs targeting ribosome proteins were purchased as an RNAi Cherry Pick library from Dharmacon ...