Labshake search
Citations for Qiagen :
301 - 350 of 754 citations for Human ADH5 siRNA since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... a second siRNA transfection was done using Hiperfect (Qiagen). siRNAs against Luciferase (used as control ...
-
bioRxiv - Cancer Biology 2021Quote: ... we used the AllStars Negative Control siRNA (cat.no 1027281, Qiagen). Both siCtrl and siFOXA1 at a concentration of 10 µM were delivered to cells using the lullaby siRNA transfection reagent (OZ biosciences) ...
-
bioRxiv - Cell Biology 2020Quote: The siRNA targeting chTOG and Hec1 were ordered from Qiagen. Hec1 was depleted with a custom synthesized siRNA sequence (5’-CCCUGGGUCGUGUCAGGAA-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... For Astrin siRNA oligo #367 (5′-TCCCGACAAC TCACAGAGAAA -3′)(Qiagen) was used as described (Thein et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... we mixed Lipofectamine 3000 and siRNA (Qiagen, Hs_PLCB1_4, SI00115521; Qiagen, Hs_PLCB1_6 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The non-targeting control siRNA (NTC) used was from Qiagen GeneGlobe (Qiagen ...
-
bioRxiv - Cancer Biology 2021Quote: ... against HNF1B compared with negative and positive control siRNA (Qiagen). 8 x 103 and 8 x 105 of VCaP cells were used in reverse transfection for 96-well plate and 6-well plate ...
-
bioRxiv - Cell Biology 2021Quote: ... We used 20 nM KDM4A FlexiTube GeneSolution siRNA (Qiagen, GS9682), 5 nM siKDM4B (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... Fibroblasts were transfected with siRNA using HiperFect transfection reagent (Qiagen). Briefly ...
-
bioRxiv - Cancer Biology 2020Quote: ... or 100 nM FlexiTube siRNA to ARF6 (Qiagen, Valencia, CA) using 9.5 μl of Oligofectamine (Life Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... or 100 nM FlexiTube siRNA to ARF6 (Qiagen, Valencia, CA) using 9.5 μl of Oligofectamine (Life Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... or 100 nM FlexiTube siRNA to ARF6 (Qiagen, Valencia, CA) for 72 hours prior to plating and then seeded at 2×104 cells/well in complete media ...
-
bioRxiv - Cell Biology 2021Quote: siRNA complexes were formed using HiPerfect transfection reagent (Qiagen, USA). The volume of siRNA for a final concentration of 15 nM per well was mixed with 6 μL of HiPerfect in 100 μL of Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were transfected with 20 nM siRNA and HiPerFect (QIAGEN), and used after 3 days.
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNA were used: All-Star control (Qiagen, SI03650318), siRNA against Arp3 (Dharmacon M-012077-01-0010) ...
-
bioRxiv - Cell Biology 2022Quote: Transient siRNA experiments were performed using HiPerfect Transfection Reagent (Qiagen, Hilden ...
-
bioRxiv - Molecular Biology 2021Quote: Small interfering RNAs (siRNAs) were purchased from (Qiagen, Hiden, Germany) (Table 1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Piezo1-targeting or control scrambled siRNA (siScrambled; Qiagen, Hiden, Germany) was transfected in proliferation medium ...
-
bioRxiv - Cell Biology 2020Quote: VSMCs were transfected with siRNA against PKCα (SI01965138, Qiagen, UK) using RNAiMAX (Invitrogen™ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 120 nM of siRNA and 0.625% HiPerFect (cat# 301704, QIAGEN) and no antibiotics ...
-
bioRxiv - Genetics 2020Quote: ... Cells were treated with an siRNA to target TRAFD1 (Qiagen catalogue 1027416 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and a Negative Control non-targeting siRNA were from Qiagen and transfected with lipofectamine RNAiMAX (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... In RNA interference experiments we used siRNA control (1027310, Qiagen) and siRNA ZnT9 (114789 ...
-
bioRxiv - Physiology 2023Quote: Lyophilized siRNAs targeting S6K1 or S6K2 were obtained from Qiagen in Flexitubes® with a preference for verified siRNA sequences ...
-
bioRxiv - Cancer Biology 2023Quote: SW480 cells were transfected with siRNA (Qiagen, Supplementary Table S1) (15 pmol/ 9.6cm2 plate ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 250 pM of AllStars Negative Control siRNA (Qiagen, 1027280) or CXCR4 siRNA (GUUUUCACUCCAGCUAACACA ...
-
bioRxiv - Cell Biology 2023Quote: ... Non-targeting siRNA was purchased from Qiagen (Catalog No. – 1027281) and used as a negative reference control ...
-
bioRxiv - Cancer Biology 2022Quote: ... or recommended All Stars negative control siRNA (cat. 1027281, Qiagen); 7.5nM of PD-L1-specific miR-455-5p TSB (339194 ...
-
bioRxiv - Cell Biology 2023Quote: ... or an equivalent amount of AllStars negative control siRNA (Qiagen) were transfected into LX2 cells using Lipofectamine 3000 transfection reagent as per manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... mouse embryos were injected with two siRNAs (Qiagen, S104403294 & S104403287) against ERH at a total concentration of 400 nM ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were transfected with scrambled control or TREM2 siRNA (Qiagen) using Lipofectamine-RNAiMAX transfection reagent (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... or from QIAGEN in the case of ATG16L1 siRNAs (Qiagen, SI04317418 and SI04999134). To assess the production of infectious viral particles ...
-
bioRxiv - Cancer Biology 2024Quote: ... siRNA for ILK (Qiagen, cat no GS3611 Flexitube Gene Solution) and was used according to manufacturers recommendations.
-
bioRxiv - Cancer Biology 2021Quote: ... AllStars Negative Control siRNA (Cat# 1027280, Qiagen, Redwood City, CA, USA) was used as a negative control ...
-
bioRxiv - Cell Biology 2020Quote: ... Fkbpl and the AllStars Negative Control siRNA were purchased from QIAGEN. For siRNA knockdown in the live-cell imaging experiments in dual-reporter cells (Figure 4 ...
-
bioRxiv - Neuroscience 2022Quote: ... STHdh cells were transfected with FlexiTube siRNA (5 nmol) from Qiagen (Mm_Csnk2a2 ...
-
bioRxiv - Cell Biology 2021Quote: The sense strand of the following siRNAs was synthesized by Qiagen: 1 ...
-
bioRxiv - Neuroscience 2020Quote: ... siRNAs targeting the 3’UTR of Arhgap11a were purchased (siRNAflex, Qiagen).
-
bioRxiv - Cell Biology 2020Quote: ... cells were transfected with the AllStars Negative Control siRNA (SI03650318, Qiagen) referred as the sictrl throughout the article.
-
bioRxiv - Cell Biology 2020Quote: ... The siRNA oligonucleotides targeting Arf1 and IRSp53 were purchased from Qiagen (Flex-iTube GeneSolution GS375 for Arf1 ...
-
bioRxiv - Cell Biology 2020Quote: ... Individual or pooled 50 nM siRNAs complexed with HiPerFect reagent (Qiagen) were added to the plated cells for 72 hours in antibiotic free complete medium at 37°C in 5% CO2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... A non targeting sequence siRNA (AllStars Negative Control QIAGEN Cat # 10272281) was used as negative control ...
-
bioRxiv - Cell Biology 2023Quote: Cos7 cells were transfected with siRNA using the HiPerfect reagent (QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... and transfection efficiency control (AllStars Hs Cell Death Control siRNA, Qiagen) in all siRNA assays ...
-
bioRxiv - Molecular Biology 2024Quote: ... SI03146479 and All Stars negative control SI03650318 siRNAs were from Qiagen. siRNA was transfected with lipofectamine RNAiMAX (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... The following siRNA were transfected at 100 μM using HiPerFect (Qiagen): ATAD5 (HSS129125) ...
-
bioRxiv - Cell Biology 2023Quote: ... using 30 nM Hs_LUZP1 siRNA (target sequence, 5′-CAGCGGGTGCTGAGAATTGAA-3′; QIAGEN) or 30 nM AllStars negative-control siRNA (QIAGEN) ...
-
bioRxiv - Neuroscience 2023Quote: ... 50 μM of AllStars Negative Control scramble siRNA (Qiagen Cat.# 1027280) was used as control.
-
bioRxiv - Cell Biology 2023Quote: The siRNAs (listed below) were purchased from Qiagen (Germantown, MD, USA) and were transfected into HEK293T cells using Lipofectamine RNAiMAX transfection reagent (#13778075 ...
-
bioRxiv - Developmental Biology 2023Quote: ... AllStars Negative CTRL siRNA was used as control (Cat#: 1027281, Qiagen). Cells were subjected to transfection 24h after plating ...