Labshake search
Citations for Qiagen :
1 - 50 of 754 citations for Human ADH5 siRNA since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CRY2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715 ...
-
bioRxiv - Cancer Biology 2024Quote: siRNAs against human ERBB4 (Hs_ERBB4_5 FlexiTube siRNA, #SI02223893 and Hs_ERBB4_6 FlexiTube siRNA, #SI02223900, Qiagen) or non-targeting control (NTC ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757 ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339 ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA for ANXA2 (Human, Qiagen, Hs_ANXA2_8, SI02632385) or siRNA for Anxa2 (Mouse ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339, human METTL3: QIAGEN SI05020414 and human DDX6 ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Cell Biology 2022Quote: Two siRNAs targeting human PRMT5 (FlexiTube siRNA Hs_PRMT5_1, cat#SI04216492 and Hs_PRMT5_2, cat# SI04248951, Qiagen) were used for knockdown experiments in HEK 293T cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... Targeted knockdown was conducted with 100nM ON-TARGETplus smartpool human c-MYC (mixture of 4 individual siRNA) and/or human KLF6-SV1 siRNA (Dharmacon, Lafayette, CO) with HiPerfect (Qiagen, Valencia, CA).
-
bioRxiv - Cell Biology 2021Quote: Oligonucleotides for siRNA included: human βPix (synthesized by Qiagen), human myosin-18A (synthesized by Qiagen)
-
bioRxiv - Cell Biology 2022Quote: ... Human ATGL-targeting and cPLA2α-targeting siRNAs and the AllStars Negative Control siRNA were from Qiagen (Germany). T863 (DGAT1 inhibitor) ...
-
bioRxiv - Cancer Biology 2022Quote: ... individual Human SHANK3 siRNA_2 (Cat. no. S100717710 Hs_SHANK3_2 siRNA, Qiagen) and individual ON-TARGETplus Human SHANK3 siRNA_7 (Cat ...
-
bioRxiv - Molecular Biology 2023Quote: A siRNA library targeting all human kinases (Qiagen, Hilden, Germany) was utilized ...
-
bioRxiv - Cell Biology 2023Quote: SiRNAs targeting human MSI2 (Supp Table S3) and nonspecific control pool siRNAs were purchased from Qiagen (Frederick, MD). Cultured cells at 50% confluence were transfected with siRNA at final concentrations of 50 nmol/L using the Lipofectamine RNAiMAX transfection reagent (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: RNA from human M1 macrophages transfected with SP140 siRNA or scrambled siRNA was extracted using a RNeasy mini-kit (Qiagen). 150 ng total RNA was labelled using the cRNA labelling kit for Illumina BeadArrays (Ambion ...
-
bioRxiv - Developmental Biology 2023Quote: FlexiTube siRNA was used to knock-down human PDE2A (Cat#: SI00040159, Qiagen). AllStars Negative CTRL siRNA was used as control (Cat# ...
-
bioRxiv - Biophysics 2021Quote: ... Small interfering RNAs (siRNAs) targeting human AKR1C1-4 were synthesized by Qiagen (Valencia, CA). HepG2-RC cells (5×106 cells/well ...
-
bioRxiv - Microbiology 2021Quote: The RTK RNAi library contained siRNAs targeting 56 human RTK genes (Qiagen, Dusseldorf, Germany), which included four different pairs of siRNAs for each gene ...
-
bioRxiv - Cell Biology 2023Quote: CD14+ human monocytes were transfected with 200 nM siRNA using the HiPerfect system (Qiagen) as described previously ...
-
bioRxiv - Cancer Biology 2022Quote: ... siRNAs: Sharpin [Hs_SHARPIN_1 HP siRNA (Qiagen)] ...
-
bioRxiv - Cell Biology 2024Quote: FlexiTube siRNA Premix siRNA (Qiagen, Germany): SI01513407|S5 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The siRNA used were Flexitube siRNA (Qiagen), a combination of 4 unique siRNAs per target ...
-
bioRxiv - Cell Biology 2022Quote: ... Knockdown of myosin VI was achieved with a pool of 4 different siRNAs (Hs_MYO6_5 FlexiTube siRNA, Hs_MYO6_7 FlexiTube siRNA, Hs_MYO6_8 FlexiTube siRNA and Hs_MYO6_10 FlexiTube, Qiagen). For rescue experiments in the U2OS Flp-In cell line expressing GFP-myosin VI ...
-
bioRxiv - Molecular Biology 2021Quote: HeLa cells were transfected with 40 nM specific human RBM10-siRNA5 or control AllStar siRNA (Qiagen) using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Immunology 2021Quote: ... 1 × 106 BM-DCs were transfected with 150nM siRNA targeting either Rtn4 or control siRNA (Mus musculus flexitube siRNA (Rtn4) or AllStars negative control siRNA (control)) (Qiagen), using HiPerfect transfection reagent (Qiagen) ...
-
bioRxiv - Biophysics 2022Quote: ... and scrambled siRNA (using control siRNA, Qiagen, 1027280) in MCF-7 and HeLa cells ...
-
bioRxiv - Cell Biology 2020Quote: ... Mm_Kif1c_2 Flexitube siRNA and Mm_Kif1c_3 Flexitube siRNA (Qiagen cat# SI00239687 and SI00239694 respectively ...
-
bioRxiv - Cancer Biology 2022Quote: ... and control siRNA [AllStars negative control siRNA (Qiagen)].
-
bioRxiv - Genetics 2023Quote: ... siRNA targeting either CTCF (Hs_CTCF_6 FlexiTube siRNA, QIAGEN) or negative control (AllStars Negative Control siRNA ...
-
bioRxiv - Cell Biology 2024Quote: ... or control siRNA (AllStar Neg. control siRNA, QIAGEN) was introduced into the DU145 cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... SLC7A11 targeting siRNA (Hs_SLC7A11_2 FlexiTube siRNA, #SI00104902, Qiagen) and control siRNA (All Stars Negative Control ...
-
bioRxiv - Developmental Biology 2021Quote: siRNA (Qiagen) and plasmid (OriGene ...
-
bioRxiv - Microbiology 2022Quote: ... siRNAs (Qiagen) used included siWTAP (SI00069853) ...
-
bioRxiv - Biophysics 2020Quote: ... The siRNAs used were Hs_TLN1_3 FlexiTube siRNA (Qiagen, SI00086975), Hs_TLN2_3 FlexiTube siRNA (Qiagen ...
-
bioRxiv - Cancer Biology 2022Quote: ... or control siRNA (25nM; AllStars Negative Control siRNA, Qiagen) were used to transfect the cells using the Lipofectamine RNAiMAX transfection reagent (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... or control siRNA (15nM; AllStars Negative Control siRNA, Qiagen) were used with the Lullaby transfection reagent (OZ Biosciences ...
-
bioRxiv - Biochemistry 2023Quote: ... Control siRNAs used were Allstars Negative control siRNAs (Qiagen).
-
bioRxiv - Cancer Biology 2022Quote: RB1-targeting siRNA (SI00007091) and AllStarNegative control siRNA (QIAGEN) were incubated in OPTI-MEM with Lipofectamin RNAiMAX (Thermofisher ...
-
bioRxiv - Biochemistry 2020Quote: ... 20nM siRNA of either ONTARGETplus siRNA for RPC5 (Horizon Discovery) or AllStars negative control siRNA (Qiagen) was used per 6 well ...
-
bioRxiv - Bioengineering 2022Quote: ... Scrambled siRNA and Alexa Fluor 546 labeled siRNA (AF546-siRNA) were purchased from Qiagen (MD, USA). mRNA targeting firefly luciferase was purchased from Trilink Biotechnologies (CA ...
-
bioRxiv - Cancer Biology 2020Quote: ... siRNAs were selected among FlexiTube GeneSolution 4 siRNA sets (Qiagen) and reordered after validation as dTdT-overhanging 19 nt RNA duplexes (Thermo) ...
-
bioRxiv - Cell Biology 2024Quote: ... non-targeting siRNA AllStars Negative Control siRNA (Qiagen Hilden, 1027281) was used.
-
bioRxiv - Genetics 2021Quote: ... FlexiTube siRNA (Qiagen) oligonucleotides against BAG3 or a scramble control were used ...
-
bioRxiv - Cell Biology 2021Quote: ... Control siRNA (Qiagen Japan ...
-
bioRxiv - Cancer Biology 2024Quote: ... Control siRNA (Qiagen), FOXM1 siRNA 1 ...
-
bioRxiv - Microbiology 2022Quote: ... AllStars Negative Control siRNA (nonsilencing siRNA; 1027281) was purchased from Qiagen and used as a negative control ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’-TAGCATTGTCAAGCTCCTAAA-3’ siRNAs or AllStars Negative Control siRNA (Qiagen, #1027281). After 72 h ...