Labshake search
Citations for Qiagen :
151 - 200 of 754 citations for Human ADH5 siRNA since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... AllStars Negative Control siRNA (Qiagen, 1027281) served as a reference point ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were transfected with siRNA (Qiagen) using Lipofectamine RNAiMAX transfection reagent (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... The following FlexiTube GeneSolution siRNAs (Qiagen) were used ...
-
bioRxiv - Cell Biology 2024Quote: ... AllStar negative control siRNA (1027280, Qiagen) was used in both experiments ...
-
bioRxiv - Cell Biology 2024Quote: ... and AllStars Negative Control siRNA (QIAGEN) were used with HiPerFect transfection Reagent (QIAGEN) ...
-
bioRxiv - Cell Biology 2023Quote: ... and Negative control siRNA (SI03650318, Qiagen), MRPL45 siRNA ...
-
bioRxiv - Immunology 2023Quote: ... The Allstars unspecific control siRNA (Qiagen) was used as a negative control (siCTL) ...
-
bioRxiv - Cancer Biology 2023Quote: ... AllStars Negative Control siRNA (#SI03650318, Qiagen) was used.
-
bioRxiv - Cancer Biology 2023Quote: ... siRNAs targeting TOP2B (Hs_TOP2B_6 FlexiTube; Qiagen), AR (SMARTpool ...
-
bioRxiv - Molecular Biology 2023Quote: ... MCT4 siRNA was purchased from Qiagen (FlexiTube GeneSolution GS9123 for SLC16A3 ...
-
bioRxiv - Developmental Biology 2024Quote: ... SFPQ siRNA #1 (Qiagen Cat#SI05783848), and SFPQ siRNA #2 (Qiagen Cat#SI05783876 ...
-
bioRxiv - Cancer Biology 2024Quote: ... AllStars Negative Control siRNA (Qiagen 1027281) was used as control ...
-
bioRxiv - Molecular Biology 2021Quote: ... Small interfering RNAs (siRNAs) were purchased from Integrated DNA Technologies (IDT) and AllStars negative-control siRNA (Qiagen) was used as a control siRNA ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: Total RNA from SNX14 siRNA- or control siRNA-treated cells was extracted using QIAzol (Qiagen, Cat# 79306) as per the manufacturer ...
-
bioRxiv - Cancer Biology 2023Quote: ... All siRNA transfections were performed using 50 nM siRNA and HiPerFect reagent (ref 301704, Qiagen, Hilden, Germany), according to the manufacturer’s traditional transfection protocol ...
-
bioRxiv - Neuroscience 2023Quote: Mouse primary hippocampal neurons grown on coverslips were transiently transfected at DIV11 with Alexa 488-labeled siRNA either specifically targeting mouse Kcc2b (Mm_Slc12a5_1 FlexiTube siRNA, GeneGlobe ID: SI01419243, GenBank accession no: NM_020333; Qiagen) or Ank3 mRNA (Mm_Ank3_3 FlexiTube siRNA ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were transfected with either a non-targeting siRNA or siRNA targeting GLE1 using HiPerFect (Qiagen, Germantown, MA). Expression plasmids (Table S1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... SAMHD1-targeting siRNA pool (siGENOME SMARTpool; M-013950-00-0005, Dharmacon) or control siRNA (AllStars Negative Control, Qiagen) were transfected at 10 nM final concentration.
-
bioRxiv - Cancer Biology 2022Quote: ... Results using SMARTpool siRNA were validated using an independent single-sequence siRNA targeting βIII-tubulin (Qiagen, cat. 1027418). MiaPaCa2 cells were re-seeded 1:3 ...
-
bioRxiv - Developmental Biology 2020Quote: ... we mixed Lipofectamine 3000 and siRNA (Qiagen, Hs_PLCB1_4, SI00115521; Qiagen, Hs_PLCB1_6, SI02781184; Qiagen, Hs_PLCE1_1, SI00115521; Qiagen, negative control siRNA, 1022076) against target genes with Opti-MEM (Gibco ...
-
bioRxiv - Immunology 2022Quote: A pool of four siRNAs specific for different regions of BACE1 or a negative control scrambled siRNA (Qiagen) were transfected into fibroblasts using Lipofectamine 2000 (Thermo Fisher) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Huh6 cell lines with siRNAs targeting PTPRK or a negative control siRNA (working concentration 30nmol/L; QIAGEN). The delivery of siRNA was achieved using Lipofectamine™ RNAiMAX Transfection Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected with siRNAs (FlexiTube, Qiagen) using Lipofectamine RNAiMAX (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2020Quote: ... we mixed Lipofectamine 3000 and siRNA (Qiagen, Hs_PLCB1_4 ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA) (Qiagen, Hs_PLCE1_1, SI00115521); negative control siRNA (UUCUCCGAACGUGUCACGUdTdT ...
-
bioRxiv - Cell Biology 2022Quote: ... or non-silencing control siRNA (Qiagen, 1027310). hMDMs were siRNA-treated two times (day 3 and day 5) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The following siRNAs were obtained from Qiagen: YTHDF1 (SI00764715) ...
-
bioRxiv - Biochemistry 2021Quote: ... Control siRNA was purchased from Qiagen (SI03650318).
-
bioRxiv - Biochemistry 2021Quote: ... Control siRNA was purchased from Qiagen (SI03650318).
-
bioRxiv - Cell Biology 2021Quote: ... All siRNA oligonucleotides were purchased from Qiagen. Cells were plated in glass coverslips ...
-
bioRxiv - Microbiology 2020Quote: ... siRNA targeting USP13 were purchased from Qiagen (FlexiTube GeneSolution GS8975 for JUN ...
-
bioRxiv - Microbiology 2020Quote: ... or 10nM siRNA duplexes targeting hnRNPL (QIAgen), hnRNPUL1 (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... or non-targeting siRNA (NT; Qiagen 1027280), or alternatively ...
-
bioRxiv - Cell Biology 2020Quote: ... with 100 nM YWHAG siRNA (Qiagen SI00100653) or Silencer Select™ non-targeting control 2 (SS2 ...
-
bioRxiv - Biophysics 2020Quote: ... and AllStars Negative Control siRNA (Qiagen, 1027281). Silenced cells were grown for 24 (beginning of migration experiments ...
-
bioRxiv - Cancer Biology 2021Quote: ... Allstars control siRNA was purchased from Qiagen. siGENOME SMARTpool pooled siRNA duplexes targeting ERBB3 were purchased from Dharmacon (sequences in Supplementary Table 1) ...
-
bioRxiv - Cell Biology 2021Quote: ... All siRNAs used were purchased from Qiagen. The siRNA used as control (siCTRL ...
-
bioRxiv - Cell Biology 2022Quote: ... The AllStars negative control siRNA from Qiagen was used as control for INF2 knockdown experiments.
-
bioRxiv - Cancer Biology 2022Quote: ... siRNA transfections were performed using Hiperfect (Qiagen).
-
bioRxiv - Microbiology 2021Quote: ... or scrambled control siRNA (Qiagen, Cat. # 1027281) using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... “AllStars negative control siRNA” (Qiagen, Venlo, Netherlands) was used as a negative siRNA control of scrambled sequence (siControl) ...
-
bioRxiv - Cancer Biology 2020Quote: ... pooled STAT3 siRNA (Qiagen, #FlexiTube GeneSolution GS6774); scrambled siRNA (Dharmacon ...
-
bioRxiv - Molecular Biology 2020Quote: ... “Allstars negative control siRNA” was from Qiagen. Cells were transfected for 48 h with 50 nM siRNA using Dharmafect 1 reagent (Dharmacon) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Lipofectamine and siRNA (Qiagen, Hs_PLCB1_4, SI00115521; Qiagen, Hs_PLCB1_6 ...
-
bioRxiv - Cell Biology 2020Quote: ... or AllStars Negative Control siRNA duplex (Qiagen) at a concentration of 50 nM ...
-
bioRxiv - Cell Biology 2021Quote: Myosin-18A siRNA – #1 CACGAACTGGAGATGGATCTA (Qiagen SI04273668), #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Cancer Biology 2021Quote: ... The AllStars negative-control siRNA from Qiagen was used as control siRNA ...
-
bioRxiv - Cell Biology 2020Quote: ... A random control siRNA (#1027281; Qiagen, UK) was used as the control ...