Labshake search
Citations for Qiagen :
451 - 500 of 754 citations for Human ADH5 siRNA since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Knockdown of EN2 gene was conducted by introducing four different siRNA primers into the cells (Qiagen, Hilden, Germany) (Table 2) ...
-
bioRxiv - Systems Biology 2022Quote: ... siRNA was transfected into RWPE-1 cells in a 24-well plate using HiPerFect Transfection Reagent (Qiagen, 301704). siRNA ...
-
bioRxiv - Microbiology 2024Quote: Cells were grown to 40% confluence and then incubated with 50 nM siRNA and Attractene transfection reagent (QIAGEN) for 36 h according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Cell Biology 2023Quote: RT-qPCR for siRNA validation was performed by extraction of RNA using the RNeasy Mini kit (Qiagen 74104) according to the manufacturer’s recommendations 24hr post siRNA transfection ...
-
bioRxiv - Cell Biology 2023Quote: siRNA targeting human GPRC5A (siGPRC5A_4 against target sequence 5′-CTGGGTGTGTTGGGCATCTTT-3′, cat# SI04438021) and non-targeting control siRNA (cat# Ctrl_AllStars_1, target sequence not disclosed) were purchased from Qiagen. Human primary keratinocytes were transfected at 20 nM final siRNA concentration using Lipofectamin 2000 reagent (Life Technologies ...
-
bioRxiv - Neuroscience 2023Quote: RNA from human microglia differentiated in vitro and human microglia extracted from human-mouse chimeras was extracted using the RNeasy Plus Micro Kit (Qiagen). The RNA from 3 independent in vitro microglia differentiations per cell line were pooled at equal weight to obtain six samples ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were passaged and transfected every 72 hours with 12.5 nM SMPD1 ON-TARGETplus SMARTpool siRNA (Dharmacon) using HiPerfect transfection reagent (Qiagen) in the absence or presence of 10 μM CBE up to 10 days in culture ...
-
bioRxiv - Microbiology 2020Quote: A549-ACE2 cells were treated with 30μM siRNA (SRPK1: Horizon M-003982-02-0010; Non-targeting: Thermo 4390843) following the HiPerfect (Qiagen) Fast-Forward protocol and plated in 6 well plates ...
-
bioRxiv - Immunology 2021Quote: ... The effects of mRNA silencing by siRNA was investigated by real-time PCR using specific QuantiTect primer Assay (Qiagen).
-
bioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNA as above (Lap2: 5’-GAUGUGACAGAGCUCUCUA from Sigma; negative control: AllStars negative control from Qiagen). Total RNA was extracted with a Nucleospin RNA kit from Macherey-Nagel according to the manufacturer’s protocol from triplicates of control and Lap2-depleted samples ...
-
bioRxiv - Molecular Biology 2020Quote: ... NRCMs were transfected with 25 nM final concentration of siRNAs by using HiPerfect transfection reagent according to the manufacturer’s instructions (QIAGEN).
-
bioRxiv - Cell Biology 2021Quote: ... HeLa cells suspended at 0.8 × 105 cells/ml were transfected with 50 nM siRNA using HiPerfect transfection reagent (Qiagen) according to the manufacturer’s protocol and analysed after 48 h ...
-
bioRxiv - Cell Biology 2022Quote: Knockdown of ARRB2/Arrestin3 in CMV:DOR-APEX2 expressing cells was performed using “reverse” transfection in which 20 pmol siRNA (Qiagen) and 12 μL RNAimax (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: siRNA targeting ARRB2 (ARRB2-12, Cat #SI03099103) and a non-targeting control (AllStars, Cat # 1027415) was purchased from Qiagen. A pool of 4 siRNAs targeting human RME-8/DNAJC13 was purchased from Dharmacon/Horizon Discovery (Cat #L-010651-01 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and 8 were transfected with a pool of cytotoxic siRNAs (“AllStars” wells, positive control, Allstars maximal death control, Qiagen). Briefly ...
-
bioRxiv - Cell Biology 2024Quote: Erc1 was genetically knocked down in B16-F1 WT cells using specific siRNA oligonucleotides targeting Rab6ip (Erc1) (Qiagen; 1027416). The cells were transfected using Lullaby transfection reagent according to the manufacturer’s instructions with a pool of 10 nM of Mus musculus Rab6ip siRNA (2.5 nM each ...
-
bioRxiv - Cell Biology 2022Quote: ... according to the transfection-protocol of primary smooth muscle cells with siRNA using HiPerFect Transfection Reagent according to the manufacturer’s instructions (Qiagen).
-
bioRxiv - Cell Biology 2023Quote: Synthetic RNA duplexes (RBM12_8, Cat. #1027417; AllStar Negative Control, Cat. #1027281) were obtained from the validated HP GenomeWide siRNA collection (Qiagen) and transfected for 72 h using Lipofectamine-RNAiMax (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... a sequence that reveals no homology with any known mammalian gene (AllStars Negative Control siRNA, cat. no. 1027292, Qiagen), as previously described (Oehlke et al. ...
-
bioRxiv - Immunology 2024Quote: ... with each of the 45 factors of interest targeted independently by four different siRNAs (Qiagen; targets in Dataset EV5). To assess the impact of siRNAs on the antiviral activity of IFN-I ...
-
bioRxiv - Molecular Biology 2024Quote: ... Depletion of ALK1 or PIEZO1 was achieved by transfecting 20 pmol of small interfering RNA (siRNA) against ALK1 (Qiagen, mixture of 2 siRNAs ...
-
bioRxiv - Microbiology 2022Quote: The human Hh signaling target PCR array (Qiagen) profiled the expression of 84 key genes responsive to Hh signal transduction ...
-
bioRxiv - Cell Biology 2020Quote: ... Human cell motility RT2 profiler PCR Array (Qiagen) for control-MPC and Givi-MPC was performed ...
-
bioRxiv - Microbiology 2021Quote: Human colon resections were placed in RNAlater (Qiagen) at the time of resection ...
-
bioRxiv - Physiology 2024Quote: ... and Qiagen human Primer Assays (Qiagen, Hilden, Germany) specific for FoxO1 and FoxO3 (the latter only in NHBEs) ...
-
bioRxiv - Microbiology 2023Quote: The human Hippo signaling target PCR array (Qiagen) was used to determine expression of 84 key Hippo target genes ...
-
bioRxiv - Microbiology 2023Quote: Human Inflammatory Response & Autoimmunity Focus) (Qiagen, YAHS-205Z) were used for each of the different samples ...
-
bioRxiv - Cell Biology 2020Quote: ... 20 ng of cDNA was used for qPCR with the Human Cellular Senescence and Human Aging RT2 Profiler™ PCR Arrays (Qiagen). Arrays were run on the 7300 Real Time PCR System (Life Technologies ...
-
bioRxiv - Developmental Biology 2022Quote: ... Total RNA from the control human TSCs as well as WWTR1-KD human TSCs were isolated using RNeasy Mini Kit (Qiagen, 74104) per the manufacturer’s protocol with on column DNase digestion ...
-
bioRxiv - Molecular Biology 2021Quote: Hepatic gene expression was investigated using qPCR arrays designed for human (RT2 Profiler PCR arrays – ‘Human Fatty Liver’, Qiagen France SAS). Then ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were transfected with 200 nM of ON-TARGETplus SMARTpool siRNA targeting TUBB6 (Table S11) or the ON-TARGETplus Non-targeting control pool (Dharmacon) using HiPerfect transfection system (Qiagen) in RPMI ...
-
bioRxiv - Cell Biology 2022Quote: ... LRRCC1-si2 (target sequence: 5’- TTA GAT GAC CAA ATT CTA CAA - 3’) and control siRNA (AllStars Negative Control) were purchased from Qiagen. siRNAs were delivered into cells using Lipofectamine RNAiMAX diluted in OptiMEM medium (ThermoFisher Scientific) ...
-
bioRxiv - Biochemistry 2020Quote: ... 5.6 x 105 cells were seeded in 4 ml DMEM in a 6-cm culture plate and transfected with targeting or control siRNA (Table 4) (from Qiagen) to a final concentration of 20 nM for each siRNA used ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary OPCs growing on 6-well plates at 80% confluency were transfected with a concentration of 25 nM siRNA and 9 μl HiPerFect transfection reagent (301705, Qiagen) in the differentiation medium ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were seeded at 50% confluency in a 10 cm dish and transfected with 200 pmol siRNA (Qiagen, Germantown, MD) using RNAiMax Lipofectamine (Life Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... p21 or p53 as well as a scrambled control siRNA were purchased from Dharmacon and employed at a concentration of 20nM using HiPerFect transfection reagent (Qiagen) and OptiMEM (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: BMDCs were transfected with the indicated siRNAs as described above and RNA was isolated using the RNEasy mini kit (Qiagen). cDNA was generated using SuperScript III first-strand cDNA synthesis kit (Invitrogen) ...
-
bioRxiv - Neuroscience 2021Quote: ... DRG neurons were transfected in serum free DMEM solution with predesigned fluorescently labelled siRNA directly against mouse TMEM120A (TACAN) from Qiagen-FlexiTube (cat ...
-
bioRxiv - Cancer Biology 2021Quote: ES2 human clear cell carcinoma cells present (wild type) or absent (siRNA) ARID1A were collected and extracted using an RNeasy Plus Micro Kit (Qiagen). Barcoded TruSeq RNA v2 libraries (Illumina ...
-
bioRxiv - Physiology 2021Quote: Total RNA was isolated from both control and high insulin-treated C2C12 myotubes before and after serum starvation or C2C12 myoblasts post siRNA transfection using the RNEasy mini kit (Qiagen). cDNA was generated by reverse transcription using qScript cDNA synthesis kit (Quanta Biosciences ...
-
bioRxiv - Immunology 2021Quote: THP-1 human monocytes or mature primary human peripheral blood derived macrophages were transfected with control (D-001810-10-05, Dharmacon) or SP140 (L-016508-00-0005, Dharmacon) SMARTpool siRNA (100nM) using HiPerfect reagent (Qiagen) or RNAiMAX (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... K-R or K-Q mutant cells (post PNKP 3’-UTR siRNA transfection and GO/Bleo treatment) was performed using the QiaAmp DNA Micro kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: Murine aortic SMCs in 12-well plates were transfected with 150ng siRNA (FlexiTube GeneSolution GS56458 for Foxo1, FlexiTube GeneSolution GS56484 for Foxo3, and FlexiTube GeneSolution GS54601 for Foxo4; Qiagen), respectively ...
-
bioRxiv - Cancer Biology 2023Quote: RNA was harvested from melanoma cells 48 hours after siRNA or overexpression vector transfection by using RNeasy Plus mini kit (Qiagen) according to the manufacturer’s instructions ...
-
The intersection of endocrine signaling and neuroimmune communication regulates neonatal nociceptionbioRxiv - Neuroscience 2024Quote: ... The knockdown efficiency of the siRNAs was determined by real-time RT-PCR after RNA isolation using RNeasy Mini Kits (Qiagen) and cDNA synthesis by SuperScript II ...
-
bioRxiv - Cancer Biology 2024Quote: ... Transfections were performed using Polyplus jetPRIME with 15nM siRNAs targeting both the wild-type and mutant NPM1 (AAAGGTGGTTCTCTTCCCAAA) (Hs_NPM1_7, SI02654960, Qiagen, Hilden, Germany) or AllStars negative control siRNA (cat# 1027281 ...
-
bioRxiv - Cell Biology 2024Quote: ... target sequence 5’-TTGCTTGGAGGCTACTCCCAA-3’) and control non-silencing scrambled siRNA (siSCR, target sequence 5’-AATTCTCCGAACGTGTCACGT-3’) were obtained from Qiagen. MAPK15-specific siRNA #2 (siMAPK15 #2 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Total RNA from the control human TSCs as well as GATA2-KD and GATA3-KD human TSCs were isolated using RNeasy Mini Kit (Qiagen, Germantown, MD) per the manufacturer’s protocol with on-column deoxyribonuclease digestion ...
-
bioRxiv - Immunology 2024Quote: ... RT2 Profiler PCR Array Human Inflammatory Response & Autoimmunity (Qiagen) was used according to the manufacturer’s protocol ...