Labshake search
Citations for Qiagen :
1101 - 1150 of 1933 citations for Mouse DPH7 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: Constructs for recombinant bacterial protein expression were all cloned in the pQE plasmid (Qiagen). Su9-DHFR and CaM-3C-Alfa-Sec61β(2–60)-OMP25(112–145)F128Amber were cloned downstream of a His14-bdSUMO tag ...
-
bioRxiv - Cell Biology 2022Quote: Plasmid DNA transfections in HEK293FT cells were performed using Effectene transfection reagent (#301425, QIAGEN), according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2022Quote: ... The PCR product was PCR-purified and the plasmid digest was gel-extracted (Qiagen), after which the two were assembled together using Gibson assembly (New England Biolabs ...
-
bioRxiv - Genetics 2022Quote: ... The source plasmid was purified using the QIAprep Spin Miniprep Kit (Qiagen, Germantown, MD), linearized with NcoI-HF (NEB ...
-
bioRxiv - Immunology 2022Quote: ... Plasmid DNA was purified using standard mini- or midi-prep purification kits (Qiagen, USA). It is recommended that purified plasmids are sequenced to ensure correct construction ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plasmid purification was performed using the Qiagen QIAprep Spin Miniprep Kit (Qiagen, Cat#27106). Plasmids were verified by restriction enzyme digestion and sequencing (Sanger sequencing ...
-
bioRxiv - Plant Biology 2023Quote: ... Plasmids were extracted from individual colonies using a QIAprep Spin Miniprep Kit from Qiagen. Plasmids were individually sanger sequenced using both CloneJET specific primers and primers internal to CsPRR37 ...
-
bioRxiv - Plant Biology 2023Quote: ... Plasmid DNA was purified from positive clones using the QIAprep Spin Miniprep Kit (Qiagen). The cDNA sequence was verified by Sanger sequencing using T7 and SP6 primers.
-
bioRxiv - Bioengineering 2023Quote: ... 16 hours and plasmid DNA was extracted using the QIAprep Spin Miniprep Kit (Qiagen). Final verification was performed via Sanger sequencing (Eurofins) ...
-
bioRxiv - Cell Biology 2023Quote: ... Large-scale isolation of plasmid DNA was done using the QIAprep maxiprep kit (Qiagen) from 150 mL of overnight culture ...
-
bioRxiv - Biochemistry 2023Quote: ... All transformed clones were purified using the QIAfilter Plasmid Maxi Kit (Qiagen, Hilden, Germany) to obtain the phagemid library.
-
bioRxiv - Genomics 2023Quote: ... and the plasmid library was extracted using a QIAprep Spin Miniprep Kit (Qiagen, Germany).
-
bioRxiv - Cell Biology 2023Quote: ... The Brunello library was amplified with the QIAGEN Plasmid Plus Mega Kit (Qiagen; #12981). For virus production ...
-
bioRxiv - Genetics 2023Quote: ... Plasmids were extracted from expanded colonies using the QIAprep Spin Miniprep kit (Qiagen, 27104), according to supplied kit instructions.
-
bioRxiv - Synthetic Biology 2023Quote: ... plasmids clones were purified from Lactobacillus gasseri using the QIAprep spin Miniprep kit (Qiagen) with addition of 100μg/mL of Lysozyme and 5U/mL of Mutanolysin to buffer P1 with an incubation time of 30 minutes prior to lysis buffer addition ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... DNA from selected BACs for was extracted by Plasmid Midi Kit (QIAGEN, Hilden, Germany) according to manufacturer’s protocol.
-
bioRxiv - Cell Biology 2022Quote: Plasmid DNA transfections in HEK293FT cells were performed using Effectene transfection reagent (#301425, QIAGEN) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... Large-scale isolation of plasmid DNA was done using the QIAprep maxiprep kit (Qiagen) from 150 mL of overnight bacterial culture supplemented with appropriate antibiotics ...
-
bioRxiv - Genetics 2023Quote: ... The plasmids of individual clones were extracted using QIAprep Spin Miniprep Kit (Qiagen, 27106) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmid DNA was obtained using the QIAprep Spin Miniprep Kit (Qiagen #27106, Hilden, Germany). Sanger sequencing was performed by SourceBioscience (Cambridge ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmid from colonies growing in spectinomycin was extracted using QIAprep spin miniprep kit (QIAGEN) and introduction of the new guide was confirmed via Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... Digested plasmid backbone and PCR product were gel extracted (QIAquick Gel Extraction Kit; Qiagen) and ligated for 2h at 24°C using T4 DNA ligase (Invitrogen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... bacterial colonies were collected and isolated using the Plasmid Plus Midi Kit (Qiagen 12941). 20nt ...
-
bioRxiv - Synthetic Biology 2024Quote: ... extracted plasmid libraries were diluted to 0.5 ng/µL in Buffer EB (Qiagen, 19086) and Kapa Hifi HotStart Ready mastermix (Roche ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 114269)34 and plasmid DNA was purified using the QIAprep Spin Miniprep Kit (Qiagen, 27104).
-
bioRxiv - Microbiology 2023Quote: ... The recombinant plasmid was purified using QIAgen mini prep kit (cat no.27106, Qiagen) as per manufacture’s protocol ...
-
bioRxiv - Microbiology 2023Quote: Plasmids were purified from overnight bacterial cultures using a QIAprep Spin Miniprep Kit (Qiagen). Polymerase chain reactions (PCR ...
-
bioRxiv - Immunology 2023Quote: ... DNA was purified from bacterial cultures using a HiSpeed Plasmid MidiPrep Kit (Qiagen, #12643), and cloned products were validated with whole-plasmid sequencing or Sanger sequencing of the insert ...
-
bioRxiv - Molecular Biology 2023Quote: Plasmid DNA was extracted from yeast using Qiagen QIAprep Spin Miniprep Kits (Qiagen, 27104). 500uL Resuspension Buffer PI was added to thawed pellets ...
-
bioRxiv - Molecular Biology 2023Quote: ... the cosmids were isolated using a Midiprep and a QIAfilter plasmid midi kit (QIAGEN). The cosmids were then digested for 2 hours at 37°C and heat-inactivated for 20 minutes at 80°C using SpeI-HF (New England Biolabs) ...
-
bioRxiv - Biophysics 2023Quote: ... isolated from large volumes of bacterial cultures using Endotoxin free Plasmid Purification kits (Qiagen). Linear PEI (25kDa ...
-
bioRxiv - Cancer Biology 2023Quote: ... Bacterial colonies were screened by PCR (F:CTCGACTAGGGATAACAGGG R:CAAAGAGATAGCAAGGTATTCAG) and successful plasmid clones miniprepped (Qiagen) and sequence verified by Sanger sequencing ...
-
bioRxiv - Synthetic Biology 2023Quote: ... we midi-prepped these cultures via alkaline lysis (Qiagen Plasmid Plus Midi-Prep Kit). This first cloning step enabled generation of intermediate products ...
-
bioRxiv - Immunology 2023Quote: ... and plasmids purified using a QIAprep Spin Miniprep Kit (Qiagen, Inc., Chatsworth, CA, USA). For analysis of the 5’ RACE products ...
-
bioRxiv - Cell Biology 2023Quote: ... Large-scale isolation of plasmid DNA was done using the QIAprep maxiprep kit (Qiagen) from 150 mL of overnight bacterial culture supplemented with appropriate antibiotics ...
-
bioRxiv - Plant Biology 2024Quote: ... and their plasmid DNA was extracted using the QIAprep Spin Miniprep Kit (Qiagen, USA). The pDNA from these colonies was pooled together and used to retransform new CA-free cells ...
-
bioRxiv - Genomics 2023Quote: ... All donor plasmids or fragments were column purified using a PCR purification kit (Qiagen) and eluted into injection buffer before injection ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we isolated plasmids using a Qiagen QIAprep Spin Miniprep Kit (Qiagen, Germany, product #27104), following the manufacturer’s instructions apart from eluting the DNA in 30 uL of H2O instead of 50 uL of Elution Buffer ...
-
bioRxiv - Cell Biology 2023Quote: Plasmid DNA transfections in HEK293FT cells were performed using Effectene transfection reagent (#301425, QIAGEN), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... and plasmid extraction was followed by purification using the QIAprep Spin Miniprep Kit (Qiagen). Sequences were validated by Sanger sequencing (Eurofins Genomics) ...
-
bioRxiv - Cell Biology 2024Quote: ... Large-scale isolation of plasmid DNA was conducted using the QIAprep maxiprep kit (QIAGEN) from 150 mL overnight bacterial culture supplemented with appropriate antibiotics ...
-
bioRxiv - Cell Biology 2024Quote: ... Small-scale isolation of plasmid DNA was conducted using a QIAprep miniprep kit (QIAGEN) from 2 mL overnight bacterial culture supplemented with appropriate antibiotics ...
-
bioRxiv - Cell Biology 2024Quote: ... The digested plasmid was then purified using the QIAEXII Gel Extraction Kit (Qiagen, Q20021) and diluted to a final concentration of 100 ng/μL and ready for transformation.
-
bioRxiv - Cell Biology 2019Quote: ... the mouse anti-penta-His antibody (Qiagen; Catalog #34660) was used at a 1:2,000 dilution in 3% BSA in PBS with sodium azide ...
-
bioRxiv - Genetics 2019Quote: ... and mouse anti-Strep (Qiagen Cat# 34850, 1:500) with goat or donkey secondary antibodies from Jackson ImmunoResearch used 1:500 ...
-
bioRxiv - Biophysics 2019Quote: ... Biotinylated mouse anti-5xHis antibody was purchase from QIAGEN. Mouse anti Tubulin beta 3 antibody from BioRad (Hercules ...
-
bioRxiv - Synthetic Biology 2021Quote: ... or mouse anti-RGS-His antibody (Qiagen; cat # 34610) at 1:5000 dilution followed by goat anti-rabbit-HRP conjugate (Abcam ...
-
bioRxiv - Microbiology 2022Quote: ... and RT2 profiler PCR Arrays: Mouse Antiviral response (Qiagen). Data analyses were performed using the GeneGlobe (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse antibodies against the His-tag (1:1000, Qiagen), rabbit antibodies against the C-terminal region of the collagen VI α1 chain (1:1000 ...
-
bioRxiv - Cell Biology 2021Quote: Mouse MSCs RT2 Prolifer PCR array (PAMM-084ZG, Qiagen) was used to evaluate the expression of 84 specific genes related to autophagy using manufacturer’s instructions ...