Labshake search
Citations for Qiagen :
951 - 1000 of 1933 citations for Mouse DPH7 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2021Quote: ... Plasmid DNA preparation was carried out with the QIAprep Spin Miniprep Kit (Qiagen). Pre-cast 4–12% (wt/vol ...
-
bioRxiv - Neuroscience 2021Quote: ... Expanded plasmids were purified using the QIAprep Spin MiniPrep Kit (Qiagen, cat. # 27106). LUHMES cells were electroporated and transfected with 2 μg of plasmid using the Amaxa™ Basic Primary Neurons Nucleofector™ Kit and protocol (Lonza ...
-
bioRxiv - Microbiology 2021Quote: ... Correct plasmid DNA was then purified with the QIAprep Spin Miniprep kit (Qiagen) prior to further use.
-
bioRxiv - Biophysics 2021Quote: ... DNA plasmids were purified using anion-exchange gravity flow chromatography (Qiagen, Hilden, Germany).
-
bioRxiv - Cancer Biology 2020Quote: ... to eliminate residual plasmid sequence and purified with QIAquick PCR Purification columns (Qiagen). The linearized constructs were subjected to Sssl methylation (or mock reactions ...
-
bioRxiv - Cell Biology 2021Quote: ... All plasmids were isolated using MiniPrep DNA isolation kits (Qiagen, Valencia, CA, USA) following a variant protocol for DNA isolation termed MiraPrep [73] ...
-
bioRxiv - Cell Biology 2021Quote: A Wnt-specific TCF/LEF-driven reporter plasmid was used (Qiagen, Valencia, CA). The C2C12 cells were trypsinized and seeded in triplicate wells at 50,000 cells/well in 12-well plates on day 1 ...
-
bioRxiv - Systems Biology 2021Quote: ... Amplified plasmid was recovered using a standard mini prep kit (Qiagen, Hilden, Germany) and sent for sequencing.
-
bioRxiv - Plant Biology 2021Quote: ... To isolate high concentrations of each plasmid a Midi preparation (Qiagen, Hilden, Germany) was performed ...
-
bioRxiv - Neuroscience 2019Quote: ... The final plasmid DNA was collected using the Endofree Maxi-prep kit (Qiagen). To produce each fragment ...
-
bioRxiv - Microbiology 2021Quote: ... All plasmids were extracted using the QIAprep Spin miniprep kit (QIAGEN, Hilden, Germany). All DNA measurements were performed using a BioSpec-nano (Shimadzu ...
-
bioRxiv - Cell Biology 2021Quote: ... The plasmid was digested overnight with XbaI followed by column purification (28104, Qiagen). We used RNA guide GTGAACCGCATCGAGCTGAA to target eGFP [20] which was complexed in vitro with our Cas9-mSA enzyme ...
-
bioRxiv - Cancer Biology 2021Quote: ... Colonies were picked and plasmids were prepared using QIAprep Spin Miniprep Kit (QIAGEN). T7-endonuclease mismatch detection assay was performed following manufacturer’s protocol using Alt-R Genome Editing Detection Kit (IDT ...
-
bioRxiv - Developmental Biology 2022Quote: ... Linearized plasmid was gel purified with QIAquick® Gel Extraction Kit (28704, Qiagen).
-
The formation of a fuzzy complex in the negative arm regulates the robustness of the circadian clockbioRxiv - Molecular Biology 2022Quote: ... plasmids were isolated and purified using the QIAprep Spin Miniprep kit (Qiagen, 27106), and PCR of the final linear cassette was done as stated above except using primers MSJ001F and MSJ006R ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plasmid DNA of the pooled culture was isolated using a Midiprep Kit (Qiagen) and PCR was used to generate amplicons containing the 5’ fragment of the split-ribozyme ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmids were isolated from the transformed ElectroMax cells (Qiaprep Spin Miniprep Kit, Qiagen), and assembled library composition was confirmed by high-throughput sequencing ...
-
bioRxiv - Cell Biology 2022Quote: ... Then the S2R+ cells were transfected with plasmids using Effectene transfection reagent (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... plasmids were column-purified with QIAprep Spin Miniprep Kit (27106, Qiagen, Hilden, Germany). After verification by restriction mapping analysis and Sanger sequencing of payload TUs ...
-
bioRxiv - Microbiology 2021Quote: ... All plasmids were isolated using MiniPrep DNA isolation kits (Qiagen, Valencia, CA, USA) following a variant protocol for DNA isolation termed MiraPrep (63) ...
-
bioRxiv - Neuroscience 2021Quote: ... Plasmid DNA was purified using the Qiagen Maxi Prep kit (Qiagen Cat#10023). AAVs were also packaged by Vector Builder into AAV2/9 ...
-
bioRxiv - Biochemistry 2021Quote: ... pUC57-CYP168A1 plasmids were isolated using the Qiagen Miniprep Kit (Qiagen, Hilden Germany). The CYP168A1 optimized cDNA insert was removed from the plasmid using NdeI and HindIII restriction enzymes and isolated using agarose gel electrophoresis and the Qiagen Gel Extraction Kit (Qiagen ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Clones carrying plasmids with correct sequences were isolated for DNA extraction (QIAGEN, 56604785).
-
bioRxiv - Genetics 2022Quote: ... Plasmid DNA of positive clones was obtained using QIAprep Spin Miniprep Kit (Qiagen). The absence of mutations was verified by capillary sequencing ...
-
bioRxiv - Neuroscience 2019Quote: ... Small-scale isolation of plasmid DNA was performed with Mini-Prep kits (Qiagen); large-scale DNA plasmid purification was done with GenElute HP Endotoxin-Free Plasmid Maxiprep Kits (Sigma-Aldrich Corp.).
-
bioRxiv - Microbiology 2019Quote: ... coli host JM109 and isolated with a commercial plasmid isolation kit (Qiagen Inc.). For cloning PCR fragments ...
-
bioRxiv - Systems Biology 2021Quote: ... The plasmid DNA was then extracted with a QIAprep Spin Miniprep Kit (Qiagen), and Sanger sequenced to verify correct assembly of the vector and to extract barcode sequences ...
-
bioRxiv - Synthetic Biology 2021Quote: ... from which the plasmids were purified using the QIAprep Spin Miniprep Kit (Qiagen) and the DNA sequences were confirmed using Sanger sequencing.
-
bioRxiv - Molecular Biology 2020Quote: ... Samples of DNA were prepared with Qiagen Plasmid Plus Maxi kits (Qiagen 12963) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: Plasmid DNA was purified using the Miniprep kit (QIAprep Spin, Qiagen, Hilden, Germany) with modified protocol ...
-
bioRxiv - Microbiology 2021Quote: ... cultures were centrifuged at 4100g and plasmids purified using a miniprep kit (Qiagen). We measured the concentration of dsDNA in each miniprep using the Qubit-4 fluorometer and the associated dsDNA high sensitivity assay kit (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... cultures were centrifuged at 4100g and plasmids purified using a miniprep kit (Qiagen). The concentration of dsDNA in each miniprep was measured using the Qubit-4 fluorometer and the associated dsDNA high sensitivity assay kit (Invitrogen) ...
-
bioRxiv - Genetics 2020Quote: ... positive colonies were amplified and plasmids purified using a Qiagen Midiprep kit (Qiagen) according to the manufacturer’s specifications.
-
bioRxiv - Molecular Biology 2020Quote: ... The plasmids were purified using a QIAprep® Spin Miniprep kit (Qiagen, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: ... Linearized plasmid and PCR fragments were gel purified using QIAquick columns (28115, Qiagen). Inserts and backbones were assembled using Gibson assembly (New England Biolabs E2611 ...
-
Engineering of a fluorescent chemogenetic reporter with tunable color for advanced live-cell imagingbioRxiv - Molecular Biology 2021Quote: ... Small-scale isolation of plasmid DNA was done using QIAprep miniprep kit (Qiagen) from 2 mL overnight bacterial culture supplemented with appropriate antibiotics ...
-
bioRxiv - Physiology 2021Quote: ... Linearized plasmids and PCR fragments were gel purified using QIAquick columns (QIAGEN – 28115). PCR fragments and plasmid backbones were assembled using Gibson assembly (NEB – E2611) ...
-
bioRxiv - Biophysics 2021Quote: ... and the DNA was purified using a Qiafilter plasmid midi kit (Qiagen, 12243). Biotin-containing handles were made with a PCR on pBluescript SK+ (stratagene ...
-
bioRxiv - Microbiology 2021Quote: ... and plasmid DNA was purified from each sample (QIAprep Spin Miniprep Kits, QIAgen). All plasmid inserts were Sanger sequenced bi-directionally using M13 forward and reverse primers (Beijing Genome Institute (BGI ...
-
bioRxiv - Genetics 2021Quote: ... Linearized plasmids and PCR fragments were gel purified using QIAquick columns (Qiagen, #28115) and joined using either Gibson assembly (NEB ...
-
bioRxiv - Immunology 2022Quote: ... Vectors for hydrodynamic delivery were produced using the QIAGEN plasmid PlusMega kit (QIAGEN). Equivalent DNA concentration between different batches of DNA was confirmed to ensure reproducibility among experiments.
-
bioRxiv - Plant Biology 2022Quote: ... plasmids were rescued from yeast as described using the QIAprep Miniprep Kit (QIAGEN, Chadstone Centre ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmid isolation was carried out using QIAprep Spin mini-prep kit (QIAgen, 27104) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2022Quote: ... to remove template plasmid and subsequently purified (QIAquick PCR Purification Kit, Qiagen, Germany). Two gene fragments were synthesized (Twist Bioscience ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plasmid DNA preparation was carried out with the QIAprep Spin Miniprep Kit (Qiagen).
-
bioRxiv - Molecular Biology 2022Quote: ... Bacterial colonies were harvested and isolated using the Plasmid Plus Midi Kit (Qiagen). Four putative regulatory ...
-
bioRxiv - Molecular Biology 2022Quote: ... which was first prepared by using a Qiagen Plasmid Maxi Kit (12963, Qiagen) and further purified by CsCl equilibrium ultracentrifugation with ethidium bromide (Sambrook et al ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plasmid DNA was isolated from bacterial hosts using QIAprep Spin Miniprep kits (Qiagen).
-
bioRxiv - Cell Biology 2023Quote: ... Exemplary colonies were scaled up for plasmid isolation via midiPrep (Qiagen, Hilden, Germany). 293A cells were plated in 96-well cell culture plates at 30,000 cells/well in absence of antibiotics ...
-
bioRxiv - Developmental Biology 2022Quote: ... Plasmid was purified from selected colony using the QIAprep Spin Miniprep Kit (Qiagen), checked for insertion using restriction enzyme digest with Eco-RI (NEB ...