Labshake search
Citations for Qiagen :
901 - 950 of 5919 citations for hsa mir 150 3p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... and DNAse-treated with the RNAse-free DNAse Set (QIAGEN). Samples were reverse transcribed using the TaqMan Reverse Transcription Kit (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and DNase-treated with the RNase-Free DNase Set (Qiagen). RNA was quantified using Qubit Fluorometric Quantitation (Life Technologies) ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was treated with an RNase-free DNase set (Qiagen). The purified RNA was quantified spectrophotometrically (NanoDrop ND-1000).
-
bioRxiv - Molecular Biology 2021Quote: ... with on-column DNA digestion (RNase-free DNase Set, Qiagen) according to the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2019Quote: 2.3.1 The Mini-Genomic DNA Buffer Set (Qiagen, Cat #: 19060) can be used to isolate the genomic DNAs from animal tissue samples.
-
bioRxiv - Neuroscience 2019Quote: ... and genomic DNA contamination quality control parameters set by Qiagen’s methods (RT2 Profiler PCR Array Data Analysis v3.5) ...
-
bioRxiv - Plant Biology 2020Quote: ... A DNase Digestion with the RNase-free DNase set (QIAGEN) was included in the procedure ...
-
bioRxiv - Cancer Biology 2021Quote: ... and concentration using the RNase-Free DNase Set (Qiagen 79254) and QIAquick PCR Purification Kit (Qiagen 28104) ...
-
bioRxiv - Cell Biology 2021Quote: ... set on HIGH and purified with Qiagen MinElute kit (Qiagen). After fragmentation ...
-
bioRxiv - Plant Biology 2020Quote: ... followed by DNAse treatment (RNase-free DNase set; Qiagen, Germany) and reverse transcription reaction (Omniscript RT kit ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA was treated with the RNase-free DNase Set (Qiagen) and quantified using the Qubit dsRNA High Sensitivity kit (Invitrogen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and subsequently treated with RNase-Free DNase Set (QIAGEN #79254).
-
bioRxiv - Neuroscience 2020Quote: ... Total RNA was treated with RNase-Free DNase Set (Qiagen), following the kit’s instruction ...
-
bioRxiv - Plant Biology 2020Quote: ... DNA was removed using the RNase-Free DNase Set (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was treated with the RNase-Free DNase Set (Qiagen) with the manufacturer’s recommendations.
-
bioRxiv - Microbiology 2020Quote: ... DNase treatment was performed using a DNase set (Qiagen, 79254). cDNA was then synthesized using 1 μg input RNA by BIO-RAD iScript gDNA Clear cDNA Synthesis Kit (1725035) ...
-
bioRxiv - Genomics 2022Quote: ... with the Genomic DNA Buffer Set (Qiagen; Cat. no. 19060) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... DNA was removed using the RNase-Free DNase Set (QIAGEN). RNA was quantified with Nanodrop 2000 ...
-
bioRxiv - Cell Biology 2019Quote: ... siRNAs were purchased as a set of four from Qiagen for myosin IIA (GS17886) ...
-
bioRxiv - Neuroscience 2022Quote: ... DNA was removed using RNAse-free DNAse set (Qiagen, 79254) using the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA was treated with DNase (DNase-Free DNase Set, Qiagen) and repurified using the RNeasy micro plus Kit (Qiagen) ...
-
bioRxiv - Plant Biology 2019Quote: ... and was treated with DNase (RNase-Free DNase Set, Qiagen). Methods for RT-qPCR and transcriptome analyses can be found in Methods S6.
-
bioRxiv - Developmental Biology 2019Quote: ... Isolated RNA was DNAse-treated with the DNase set (Qiagen), column purified using RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... siRNAs were selected among FlexiTube GeneSolution 4 siRNA sets (Qiagen) and reordered after validation as dTdT-overhanging 19 nt RNA duplexes (Thermo) ...
-
bioRxiv - Physiology 2021Quote: ... and Genomic DNA Buffer Set (all from Qiagen, Hilden, Germany), essentially following the protocol described in the Qiagen Genomic DNA Handbook ...
-
bioRxiv - Pathology 2019Quote: ... DNase treatment was performed using RNase-Free DNase Set (Qiagen) and then purified using RNeasy® MinElute® Cleanup Kit (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... RNA samples were treated with RNase-Free DNase Set (Qiagen) to remove any DNA ...
-
bioRxiv - Plant Biology 2019Quote: ... A DNase digestion with the RNase-free DNase set (QIAGEN) was performed ...
-
bioRxiv - Plant Biology 2021Quote: ... an on-column DNAse digest (RNase-Free DNase Set, Qiagen), and eluting 2x with 50 μL RNAse free water ...
-
bioRxiv - Cancer Biology 2020Quote: ... including DNase I digestion step (RNase-Free DNase set, Qiagen). 1 μg of RNA was reverse transcribed (iScript cDNA Synthesis Kit (BioRad) ...
-
bioRxiv - Cell Biology 2020Quote: ... or the RNeasy Mini kit RNase-Free DNase set (QIAGEN) in triplicate according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... with an additional DNAse treatment (Qiagen RNase-Free DNase Set). RNA concentration ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was treated with DNase (DNase-Free DNase Set, Qiagen) and repurified using the miRNeasy micro plus Kit (Qiagen) ...
-
bioRxiv - Physiology 2022Quote: ... combined with on-column DNase digestion (DNase Set, 79254, Qiagen) as described in the manufacturer’s instruction ...
-
bioRxiv - Immunology 2023Quote: ... and additionally purified using an RNase Free DNase Set (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and RNase-Free DNase Set (Cat#79254, QIAGEN, GmBH, Germany). Sequencing libraries were constructed following steps from the manufacturer’s instructions (VAHTS Universal V6 RNA-seq Library Prep Kit for Illumina® ...
-
bioRxiv - Cancer Biology 2023Quote: ... and on-column DNase digestion (RNase-free DNase Set, Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... with on column DNase digest (RNase-Free DNase Set, QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and RNase-Free DNase Set (cat# 79254, QIAGEN, GmBH, Germany). cDNA libraries were constructed following Illumina standard protocols and sequenced with an Illumina NovaSeq 6000 by SHBIO (Shanghai ...
-
bioRxiv - Neuroscience 2023Quote: ... treated with DNase (RNase-Free DNase Set, QIAGEN; Milan, Italy) and eluted in RNase/DNase-free water ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was depleted using the RNase-Free DNase Set (Qiagen). In the final step ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was treated with RNase-free DNase set (QIAGEN). RNA-seq libraries were generated using the NEBNext Globin&rRNA depletion kit and the NEBNext UltraII Directional RNA Library prep kit according to the manufacturer’s protocols (New England Biolabs ...
-
bioRxiv - Bioengineering 2024Quote: ... including DNase treatment with RNase-Free DNase Set (Qiagen, #79254). At the final step ...
-
bioRxiv - Immunology 2024Quote: ... Residual DNA was removed using RNAse-Free DNase Set (Qiagen). RNA was assessed for quality and quantity (TapeStation ...
-
bioRxiv - Plant Biology 2024Quote: ... and treated with the RNase-Free DNase Set (Qiagen, Germany). 1 μg total RNA was reverse transcribed with oligo dT using Sensifast cDNA Synthesis kit (Meridian Bioscience ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was treated with DNase (DNase-Free DNase Set, Qiagen) and repurified using the RNeasy micro plus Kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was depleted with the RNase-free DNase Set (Qiagen). The quality of purified RNA was tested on an Aligent 2200 Tapestation using RNA screentape ...
-
bioRxiv - Microbiology 2021Quote: ... Transposon junctions were amplified by using a transposon specific primer Mariner_1R_TnSeq_noMm (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCGGGGACTTATCAGCCAACC) and P7 (CAAGCAGAAGACGGCATACGAGAT) primers with HotStarTaq Master Mix Kit (Qiagen). The following PCR condition was used ...
-
bioRxiv - Microbiology 2019Quote: ... Transposon junctions were amplified by using a transposon specific primer Mariner_1R_TnSeq_noMm (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCGGGGACTTATCAGCCAACC) and p7 primers (CAAGCAGAAGACGGCATACGAG) with HotStarTaq Master Mix Kit (Qiagen) with the following PCR condition (94 °C for 3 min ...
-
bioRxiv - Cell Biology 2024Quote: ... 4 μL of cDNA was added to 1 μL of pre-purchased primers (QuantiTect primers (Qiagen, Germany)) and qPCR was carried using the StepOnePlus machine (Thermo Fisher Scientific ...