Labshake search
Citations for Qiagen :
1051 - 1100 of 5919 citations for hsa mir 150 3p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... or to mature primate-specific miR-608 (AM608, 15-mer, as a control with no predicted complementary sequences in mice) (LNA, Exiqon, Qiagen). DIO mice were injected intravenously with 3.3 mg/kg oligonucleotide for three consecutive days and were sacrificed 0 ...
-
bioRxiv - Developmental Biology 2021Quote: 5ng/sample RNA isolated from sperm was reverse transcribed (RT) using the miCURY LNA RT kit (Qiagen #339340). Quantitative RT-PCR (qRT-PCR ...
-
bioRxiv - Immunology 2021Quote: ... 0.25μL of 2X QuantiFast RT Mix (QIAGEN), and PCR-grade water (fill to 20 μL) ...
-
bioRxiv - Cell Biology 2021Quote: ... was amplified by miScript RT Kit (Qiagen). With the resulting cDNA libraries ...
-
bioRxiv - Microbiology 2022Quote: One-Step Probe RT-qPCR kits (Qiagen) and CFX96 system/software (BioRad ...
-
bioRxiv - Immunology 2021Quote: One-Step Probe RT-qPCR kits (Qiagen) and CFX96 system/software (BioRad ...
-
bioRxiv - Cancer Biology 2022Quote: ... miScript II RT Kit (Qiagen, Hilden, Germany) was used to convert the RNA to cDNA via a thermocycler (Eppendorf ...
-
bioRxiv - Neuroscience 2023Quote: ... RT² SYBR Green qPCR Mastermix (Qiagen®) and samples cDNA and the quantitative RT-PCR was carried out with a LightCycler 480 (Roche) ...
-
bioRxiv - Genomics 2024Quote: ... The miRCURY LNA RT Ki (Qiagen, UK) was used to synthesise cDNA and miRCURY LNA RT Kit (Qiagen ...
-
bioRxiv - Neuroscience 2024Quote: ... or miRCURY LNA RT Kit (Qiagen Sciences) for analysis of mRNA or miRNA respectively ...
-
bioRxiv - Molecular Biology 2024Quote: ... The miRCURY LNA RT Kit (Qiagen, UK) was used to synthesise cDNA using 50-100ng of RNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... or miRCURY LNA RT Kit (339340; Qiagen). PCR was performed using miScript II (218073 ...
-
bioRxiv - Microbiology 2021Quote: ... The himar1 enriched samples were diluted 1:50 and amplified by using a P5 indexing primer (AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC, [i5] barcode sequence) and P7 primer HotStarTaq Master Mix Kit (Qiagen) to add unique barcodes and the necessary P5 and P7 flow cell adaptor sites for Illumina sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ... MDA controls were performed employing a random-primers-based MDA (RP-MDA) kit as random-primer-based method: Repli-g Mini Kit from QIAGEN; and a TruePrime-based-MDA (PrimPol-MDA ...
-
bioRxiv - Microbiology 2024Quote: ... transposon junctions were amplified by using a transposon-specific primer (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCGGGGACTTATCAGCCAACC) and a primer P7 (CAAGCAGAAGACGGCATACGAGAT) using the HotStarTaq master mix kit (Qiagen). The himar1-enriched samples were diluted in a ratio of 1:50 ...
-
bioRxiv - Microbiology 2024Quote: ... with ReadyMade PrimeTime primers for SPI1 (Integrated DNA Technologies Inc, USA) and RT2 qPCR Primer Assay for Human GAPDH (cat# PPH00150F-200, Qiagen). Expression was quantified using ABI Sequence Detection software compared to serial dilutions of an SPI1 or GAPDH synthetic sequence gBlock (Integrated DNA Technologies Inc ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Allele-specific expression was measured using RT-ddPCR with the One-Step RT-ddPCR Advanced Kit for Probes (Qiagen) on a QX200 ddPCR Droplet Reader (BioRad ...
-
bioRxiv - Microbiology 2019Quote: ... and Quantitect murine TNF-R1 primer assay (Qiagen) or hypoxanthine– guanine phosphoribosyltransferase (HPRT ...
-
bioRxiv - Biochemistry 2021Quote: ... QuantiTect Primer Assays from Qiagen (Venlo, The Netherlands) were used for Sftpb (QT00124908 ...
-
bioRxiv - Microbiology 2020Quote: ... and the U6 primers were provided by QIAGEN Co ...
-
bioRxiv - Cancer Biology 2020Quote: ... GAPDH and P1A Primers were obtained from Qiagen.
-
bioRxiv - Neuroscience 2022Quote: ... miScript precursor assay primers were purchased from Qiagen (mir-10b ID ...
-
bioRxiv - Pathology 2021Quote: ... Let-7 miRNA primers were purchased from QIAGEN.
-
bioRxiv - Immunology 2020Quote: ... miRNAs were quantified using miScript Primer Assays (Qiagen) and QuantiText SYBR Green PCR Master Mix (Qiagen ...
-
bioRxiv - Immunology 2021Quote: ... Primers for Ciita and Tlr7 were from Qiagen. Custom primers were used for Ppia (F ...
-
bioRxiv - Cancer Biology 2022Quote: ... QuantiTect Primer Assay for Siglece (#QT00135597, Qiagen, Germany) was used ...
-
bioRxiv - Neuroscience 2023Quote: ... using the following oligonucleotides (QuantiTect Primer Assays, Qiagen): Leptin (Mm_Lep_1_SG QT00164360 (NM_008493)) ...
-
bioRxiv - Neuroscience 2023Quote: ... and gene-specific primer pairs obtained from Qiagen. Real-time qPCR reactions were then run on a CFX96 Real-Time System C1000 Thermal Cycler (Bio-Rad ...
-
bioRxiv - Physiology 2024Quote: ... and Qiagen human Primer Assays (Qiagen, Hilden, Germany) specific for FoxO1 and FoxO3 (the latter only in NHBEs) ...
-
bioRxiv - Molecular Biology 2024Quote: Validated Primers for miRNAs were obtained from QIAGEN:
-
bioRxiv - Molecular Biology 2024Quote: ... and Actin primers were obtained from Quantitect (Qiagen).
-
bioRxiv - Molecular Biology 2021Quote: Cells were seeded in 6-well and 12-well plates at a density of 1.25×105-5×105 cells per well and transfected with miR-320a mimic (Qiagen, 339173 YM00471432) or antagomir (GenePharma ...
-
bioRxiv - Genomics 2022Quote: ... The sample was incubated at room temperature for 5 min and 3.75μL (25 fmol final concentration) of the synthetic spike-in control Caenorhabditis elegans miRNA cel-miR-39 (Qiagen, Cat. No. 219610) was spiked into samples ...
-
bioRxiv - Microbiology 2020Quote: ... An additional on-column DNAse treatment step (RNAse free DNAse set, Qiagen) was added to remove possible traces of remaining DNA co-extracted with the RNA ...
-
bioRxiv - Developmental Biology 2021Quote: ... Possible genomic DNA contamination was removed by RNase-Free DNase Set (QIAGEN) with the RNeasy columns ...
-
bioRxiv - Microbiology 2022Quote: ... DNA was removed by DNase digestion (Qiagen RNase-Free DNase I Set), then in the same column the RNA was concentrated to 15 µL using the MN NucleoSpin RNA Clean-up XS (Macherey-Nagel) ...
-
bioRxiv - Cell Biology 2022Quote: ... according to manufacturer instructions using the RNase-free DNAse Set kit (Qiagen). RNA concentration was measured with a DS-11 UV Spectrophotometer (Denovix) ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNase treatment was performed using RNase-Free DNase Set (Qiagen; Cat#: 79254) to remove residual DNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... with on-column DNase digestion (RNase-Free DNase Set, Qiagen, Hilden, Germany). 4 ug of RNA were then used for cDNA preparation using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2021Quote: ... with an on-column DNA digestion step (RNase-Free DNase Set; Qiagen). A total of 20 RNA-Seq libraries (one per individual ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and genomic DNA was digested using the RNase-Free DNase Set (Qiagen). The RNA integrity number (RIN ...
-
bioRxiv - Microbiology 2020Quote: ... An on-column DNase digestion with the RNase-free DNase Set (Qiagen) was performed to remove genomic DNA contamination in RNA samples.
-
bioRxiv - Microbiology 2021Quote: ... RNA was DNase treated using RNase-Free DNase Set (Qiagen, Hilden, Germany) and purified using RNeasy® MinElute® Cleanup Kit (Qiagen ...
-
bioRxiv - Genomics 2021Quote: ... DNAse treatment was performed with RNAse-free DNAse Set (Qiagen, ref: 79254). Equal volumes of all samples were reverse transcribed with Superscript IV reverse transcriptase (Life Technologies ...
-
bioRxiv - Molecular Biology 2020Quote: ... including an on-column DNAse treatment using RNase-free DNase set (Qiagen) to remove genomic DNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... with on-column DNase digestion (RNase-Free DNase Set, Qiagen, Hilden, Germany). Quality of the purified RNA was tested on an Agilent 2200 Tapestation using RNA screentape.
-
bioRxiv - Cancer Biology 2020Quote: ... with on-column DNase digestion (RNase-Free DNase Set, Qiagen, Hilden, Germany). cDNA was prepared from 4 μg RNA using High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Gene set enrichment analysis (GSEA;(57)) and Ingenuity Pathway Analysis (QIAGEN; (58)) software were used to compare gene sets that were differentially regulated after infection with WT and ΔGRA28 parasites.
-
bioRxiv - Immunology 2021Quote: ... an on-column DNase digestion with the RNase-free DNase set (Qiagen) was performed during total RNA isolation 62 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Residual DNA has been digested with the RNase-Free DNase Set (Qiagen); the abundant ribosomal RNA was depleted by using the Ribo-Zero rRNA Removal Kit (Illumina) ...