Labshake search
Citations for Promega :
151 - 200 of 1464 citations for 2x SYBR Green qPCR Master Mix since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative PCR (qPCR) was performed using GoTaq qPCR Master Mix (Promega). The primers used for Lrp6 were ...
-
bioRxiv - Molecular Biology 2023Quote: ... qPCR was performed with the GoTaq qPCR Master Mix (Promega, #A6001) on a Quantstudio 3 Real-Time PCR System (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... using GoTaq® qPCR Master Mix (Promega, U.S.A.) according to the manufacturers’ instructions ...
-
bioRxiv - Immunology 2021Quote: ... using the GoTaq qPCR Master Mix kit (Promega). Gene expression was normalized to the housekeeping gene Rplp0 and expressed as fold change compared to CD11cWT samples ...
-
bioRxiv - Genomics 2019Quote: ... we used the GoTaq qPCR Master Mix (Promega) at a total volume of 10 µl ...
-
bioRxiv - Genetics 2021Quote: ... with GoTaq qPCR Master Mix (Promega, Madison, WI). The fold change or percentage input of the samples was calculated using the QuantStudio™ Design & Analysis Software Version 1.2 (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... using GoTaq qPCR Master Mix (Promega, Southampton, UK). Relative gene expression was calculated using the comparative Ct method (2−δδCt)[47] ...
-
bioRxiv - Cell Biology 2021Quote: ... containing 1X GoTaq qPCR Master Mix (Promega Corporation), 300 nM CXR Reference Dye and final concentration 200nM of each SYBR green designed primers described in Supplementary Table 2 ...
-
bioRxiv - Microbiology 2021Quote: ... The GoTaq probe qPCR Master Mix (Promega, A6102) and GoTaq G2 (Promega ...
-
bioRxiv - Cell Biology 2021Quote: ... containing 1X GoTaq qPCR Master Mix (Promega Corporation), 300 nM CXR Reference Dye ...
-
bioRxiv - Physiology 2022Quote: ... with GoTaq® qPCR Master Mix (Promega, USA) and acquired with Step One software v.2.3 ...
-
bioRxiv - Neuroscience 2021Quote: ... containing 1X GoTaq qPCR Master Mix (Promega Corporation), 300 nM CXR Reference Dye ...
-
bioRxiv - Physiology 2020Quote: ... qPCR was performed using GoTaq Master Mix (Promega) and a 96 well thermal cycler (Applied Biosystems) ...
-
bioRxiv - Microbiology 2022Quote: ... and 1X GoTaq qPCR Master Mix (Promega, A6002). Amplifications were performed using a CFX Connect Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2020Quote: ... using GoTaq Probe qPCR Master Mix (Promega, USA).
-
bioRxiv - Neuroscience 2022Quote: ... and the GoTaq® qPCR Master Mix (Promega), following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... We used the GoTaq qPCR Master Mix (Promega) with MicroAmp 0.2 mL optical strips (Applied Biosystems ...
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: ... 5 μL of GoTaq qPCR Master Mix (Promega), and 250 nM primer (Supplementary Table S2) ...
-
bioRxiv - Immunology 2023Quote: ... using the GoTaq Probe qPCR Master Mix (Promega). Primers and probes were purchased from Life Technologies (Supplemental Table 5) ...
-
bioRxiv - Neuroscience 2024Quote: ... GoTaq quantitative PCR (qPCR) Master Mix (Promega; A6002) was used to conduct the qPCR ...
-
Activation of XBP1s attenuates disease severity in models of proteotoxic Charcot-Marie-Tooth type 1BbioRxiv - Neuroscience 2024Quote: ... GoTaq qPCR Master Mix (Promega, Madison, WI, USA). Gene expression changes were normalised to 36B4 or Ppia gene expression by using the ΔΔCT method.
-
bioRxiv - Microbiology 2021Quote: ... Colony PCR was performed using PCR 2x Master Mix (Promega) with primers listed in Table 3.
-
bioRxiv - Microbiology 2021Quote: ... Colony PCR was performed using PCR 2x Master Mix (Promega) with primers listed in Table S3.
-
bioRxiv - Molecular Biology 2021Quote: ... and SYBR-green qPCR was performed using the GoTaq qPCR system (Promega) according to the manufacturers’ recommendations ...
-
bioRxiv - Microbiology 2022Quote: Each colony PCR consisted of a 25-μl reaction containing: 12.5 μl 2x GoTaq Green Master mix (Promega, UK), 0.5 μl of the reverse and forward primers (10 μM each) ...
-
bioRxiv - Plant Biology 2023Quote: ... Gene-specific and transposon multiplex primer PCR was performed under standard conditions with 2X GoTaq Green Master Mix (Promega) with 5% DMSO (v/v).
-
bioRxiv - Cell Biology 2022Quote: ... qPCR was performed in triplicate with the GoTaq qPCR Master Mix (Promega) in a LightCycler 480 instrument (Roche ...
-
bioRxiv - Cell Biology 2022Quote: ... QPCR was performed with GoTaq® qPCR Master Mix (Promega, Madison, WI). QPCR primers sequence will be provided upon request ...
-
bioRxiv - Microbiology 2019Quote: ... qPCR was performed using a GoTaq qPCR Master Mix kit (Promega, WI) and a QuantStudio 3 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Genomics 2021Quote: ... qPCR was done with GoTaq® qPCR Master Mix (Promega ref: A602) on ViiA 7 Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... qPCR was performed using GoTaq qPCR Master Mix (Promega, Madison, WI, USA) with StepOne Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2023Quote: ... and qPCR was performed with the Gotaq qPCR master mix (A6001, Promega) and the CFX96 Touch Real-Time PCR Detection System (Biorad) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative PCR (qPCR) was performed using Go-Taq qPCR Master Mix (Promega) with 2 µL of cDNA or ‘no RT’ sample in a 20 µL reaction volume using 100 or 200 nM final concentration qPCR primers ...
-
bioRxiv - Cell Biology 2023Quote: ... qPCR reactions were set up with GoTaq® qPCR Master Mix (Promega) using diluted cDNA (5 ng/µl) ...
-
bioRxiv - Cell Biology 2023Quote: ... qPCR was performed using GoTaq qPCR Master Mix (Promega, Madison, WI, USA) with the StepOne Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... qPCR was performed using GoTaq qPCR Master Mix (Promega, Madison, WI, USA) with the StepOne Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... qPCR was performed using GoTaq qPCR Master Mix (Promega, Madison, WI, USA) with StepOne Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2023Quote: ... Quantitative PCRs (qPCRs) were performed with GoTaq ® qPCR Master mix (Promega) following the standard cycling conditions suggested by the manufacturer in a StepOnePlus real time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2019Quote: ... and 12.5 µl of 1x of Hot Master Mix (Promega GoTaq® Green Master Mix) to a final volume of 25 µl ...
-
bioRxiv - Microbiology 2023Quote: ... using SYBR Green GoTaq 1-Step RT-qPCR (Promega) with the SARS-CoV-2 CDC N3 primers (F – GGGAGCCTTGAATACACCAAAA ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 5x GoTaq Green Master Mix (Promega, Madison, USA), 0.5 μM of each primer and 1% of DMSO ...
-
bioRxiv - Genomics 2020Quote: ... 12.5μl of 2xGoTag Green master mix (Promega™), 6.5μl of water and 2.5μl of each of the primers ...
-
bioRxiv - Neuroscience 2020Quote: ... 12.5 μL of GoTaq green master mix (Promega) and MilliQ water ...
-
bioRxiv - Microbiology 2020Quote: ... GoTaq Green Master Mix was obtained from Promega. Primers and gBlocks used in this study were acquired from Integrated DNA Technologies (IDT) ...
-
bioRxiv - Genetics 2023Quote: ... 12.5μl of GO Taq green master mix (Promega) and 2μl of template DNA (average concentration = 30ng/μl) ...
-
bioRxiv - Neuroscience 2023Quote: ... and using GoTaq Green Master Mix (Promega, Germany) at an annealing temperature of 65.5°C in a final volume of 25 µl ...
-
bioRxiv - Developmental Biology 2023Quote: ... 10 µl of GoTaq Green Master Mix (Promega), 10 µM forward primer (UW634_F 5’-AGGGACACGATTGCCTTCTG-3’) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The reaction mix included: 7.5μl of GoTaq Green master mix (Promega), 0.4μl of each primer (10μM ...
-
bioRxiv - Pathology 2023Quote: ... USA) using SYBR Green PCR or TaqMan Universal PCR master mixes (Go Taq Probe PCR Master Mix; Promega, A600A or A610A, respectively). The following TaqMan probes were used ...
-
bioRxiv - Molecular Biology 2020Quote: ... in the GoTaq®qPCR Master Mix (from Promega,), before being deactivated at 95°C for 10 min ...