Labshake search
Citations for Promega :
301 - 350 of 4976 citations for Onion Yellow Dwarf Virus OYDV PCR Kits since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... followed by reverse transcription to complementary DNA (cDNA) using 30 enzyme units(U) of the Moloney Murine Leukemia Virus reverse transcriptase (MMLV-RT) (Promega, WI, USA). The extension products were then analyzed using the ABI3730xl DNA Analyzer (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... the reduction in luciferase expression following a single round of virus infection was measured using Bright-Glo luciferase reagent and GloMax luminometer (Promega, Madison, WI). The concentrations of antibody that inhibited 50% or 80% of viral infection (IC50 and IC80 titers ...
-
bioRxiv - Neuroscience 2024Quote: ... Absolute quantification of the mRNA of 5αR1 and 5αR2 was performed using real-time RT-PCR on the Techne Quantica™ Real-time PCR system (Burlington, NJ) with SYBR Green PCR Master Mix (Promega, Madison, WI). The standard curves were generated following the procedure described by (41) ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were purified with the Wizard SV Gel and PCR Cleanup System (Promega). Plasmid DNA was isolated from bacterial cultures with the QIAprep Spin Miniprep Kit (Qiagen) ...
-
bioRxiv - Microbiology 2020Quote: ... Resulting colonies were screened by colony PCR using GoTaq Green PCR master mix (Promega), with 1 µl of Pk5’ UTR forward and Pk3’UTR reverse primers for each respective construct ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5X PCR Flexi Buffer and 2X GoTaq PCR Master Mix were purchased from Promega. An aliquot of ABIL® EM 90 by Evonik was gifted to us from Professor Shuhuai Yao’s lab (see Acknowledgements).
-
CCG•CGG interruptions in high penetrance SCA8 families increase RAN translation and protein toxicitybioRxiv - Genetics 2021Quote: ... PCR bands were extracted using Wizard SV Gel and PCR Clean-Up System (Promega) and ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... PCR products were then purified (Promega Wizard SV Gel and PCR Clean-Up System) and sequenced on both strands (Eurofins Genomics ...
-
bioRxiv - Molecular Biology 2020Quote: After PCR clean-up using Wizard SV Gel and PCR Clean-Up (Promega; A9281), samples were run in 2% agarose gel to ensure that the PCR product is compose of a single amplicon in the appropriate size ...
-
bioRxiv - Genetics 2020Quote: ... The PCR was performed using the GoTaq® Long PCR MasterMix (Promega, Charbonnieres, France) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... followed by PCR amplification across the CRISPR target sequences with DreamTaq PCR reagent (Promega) and Sanger sequencing (Eurofins genomics) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The PCR reaction was carried out using GoTaq Long PCR 2x Master Mix (Promega) for 35 cycles ...
-
bioRxiv - Microbiology 2023Quote: ... PCR fragments from the nested PCR were cloned into pGEM-T-easy vectors (Promega), and the indicated number of successful recombinant clones was randomly selected and sequenced using a 3500 Genetic Analyzer (Thermo Fisher Scientific).
-
bioRxiv - Genomics 2023Quote: ... 20 ml PCR reactions contained 10 ml GoTaq® green PCR Master mix (Promega), 6 ml nuclease-free water ...
-
bioRxiv - Biochemistry 2024Quote: RT-PCR reactions were set up using the Access RT-PCR system (Promega Corporation) following the kit procedure with 100 ng of input RNA per 25 μl reaction ...
-
bioRxiv - Microbiology 2024Quote: ... PCR reactions were performed using a 2x GoTaq PCR master mix (Promega; cat# M7122), a 5’-biotinylated M13For and a 5’-biotinylated M13Rev primers (Supp ...
-
bioRxiv - Microbiology 2024Quote: ... PCR products were gel purified (Wizard SV gel and PCR clean-up system, Promega). ExpressPlex library preparation and sequencing was done by SeqWell (MA ...
-
bioRxiv - Developmental Biology 2024Quote: ... The PCR products were purified (Promega Wizard SV Gel and PCR clean-up system), annealed for 13 cycles (Prime Star Max ...
-
bioRxiv - Microbiology 2020Quote: ... the fluorescence derived from the incorporation of BRYT Green® Dye into the double-stranded PCR products was measured at the end of each cycle using the GoTaq® qPCR Master Mix 2X Kit (Promega). The results were analysed using Bio-Rad CFX Maestro software ...
-
bioRxiv - Microbiology 2020Quote: ... The duplicate amplification products of each sample were pooled and purified with the SV Wizard PCR Purification kit (Promega, Madison, WI) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: The first step to generate the probe was to amplify the RdRp gene target from SARS-CoV-2 cDNA using GoTaq® DNA Polymerase PCR kit (Promega) and the following oligonucleotide primers RdRp Fwd 5’-AACACGCAAATTAATGCCTGTCTG 3’ and RpRd Rev 5’ GTAACAGCATCAGGTGAAGAAACA 3’ ...
-
bioRxiv - Microbiology 2022Quote: ... Bacterial counts were obtained by comparing the signals from the tested samples with a standard curve prepared by serial dilutions of a standard sample purified using the WizardSV Gel and PCR Clean-Up System Kit (Promega, USA) and subsequently cloned into the pGEM-T vector (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... and real-time PCR was performed on 30 ng of DNA with SYBR Green kit GoTaq® qPCR Master Mix (Promega). DNA from non-transduced cell was isolated and amplified at the same time to demonstrate the absence of contamination ...
-
bioRxiv - Genomics 2022Quote: ... The efficiency and specificity of the designed primers was tested through PCR using the GoTaq Green Master kit (Promega, Madison, USA) with thermal cycling conditions of 2 min at 95 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... eloB and eloC) were purified on an agarose gel using the Wizard ® SV gel and PCR clean-up system purification kit (Promega). After restriction with the corresponding restriction enzymes (New England Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: ... Amplified ORFs were then used as templates in a PCR reaction to amplify a full-length mutant amplicon followed by their purification using Wizard SV Gel and PCR Clean-Up kit (Promega, USA). These ORFs were digested with KpnI and BamHI enzymes and ligated into similarly digested pDsRed vector ...
-
bioRxiv - Microbiology 2023Quote: ... The amplified PCR fragments were checked for uniformity and size using 0.8% agarose gel electrophoresis and purified using a PCR fragment recovery kit (Promega, WI, USA). The recovered DNA fragments were sequenced using the MiSeq 500PE v.2 kit (Illumina ...
-
bioRxiv - Molecular Biology 2024Quote: ... ATRX 5ʹ-TGAAACTTCATTTTCAACCAAATGCTC-3ʹ and 5ʹ-ATCAAGGGGATGGCAGCAG-3ʹ All PCR reactions were performed using GoTaq® G2 DNA polymerase kit from Promega following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... PCR product was purified (Promega) and digested using DpnI (NEB ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR Nucleotide Mix (Promega, UK) and GoTaq® Flexi DNA Polymerase (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR nucleotide mix (Promega: U144B) and oligo (dT ...
-
bioRxiv - Genetics 2020Quote: ... PCR Master Mix 2x (Promega) was used ...
-
bioRxiv - Biochemistry 2022Quote: ... and PCR with GoTaq (Promega) using the primers-RG6 S ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR nucleotide mix (Promega; U144B) and oligo (dT ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by PCR (GoTaq, Promega), resulting in output libraries of spliced species ...
-
bioRxiv - Pathology 2024Quote: ... PCR using GoTaq (M123, Promega) was performed to genotype for presence of CreERT2 and c-Src deletion ...
-
bioRxiv - Plant Biology 2020Quote: ... First strand cDNA synthesis was carried out using 2 ug of total RNA and reverse transcription was performed using an oligo (dT) 15 primer and Moloney murine leukemia virus (MMLV) reverse transcriptase (Promega, Madison, WI, USA). qPCR was carried out using SYBR GREEN PCR Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... oligo deoxythymidylic acid (oligo-dT) primed cDNA was synthesized from 500 ng of total RNA using Murine Moloney Leukaemia Virus Reverse Transcriptase (Promega, Madison, WI, USA). RT-qPCR was performed on the ViiA 7 Real-Time PCR System (Applied Biosystems/Thermofisher ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... PHH were infected with HepAD38-derived GTD virus at 500 viral genome equivalents per cell in maintenance medium supplemented with 4 % PEG 8000 (Promega, Madison, WI; V3011). For patient sera infections ...
-
bioRxiv - Genomics 2020Quote: ... Five micrograms of RNA was reverse transcribed into cDNA using Moloney-murine leukemia virus reverse transcriptase and random primers (Promega, Madison, Wisconsin, USA) in a 20 μl reaction volume ...
-
bioRxiv - Plant Biology 2022Quote: ... Subsequently 2 μg of RNA were used to perform reverse transcription in the presence of Moloney murine leukemia virus reverse transcriptase (Promega, Madison, WI, USA) after annealing with an anchored oligo(dT)18 primer as described by (Wirth et al. ...
-
bioRxiv - Biochemistry 2024Quote: ... was synthesised from 2 µg of total RNA using the Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT; Promega, Madison, WI, USA) using random primers and oligo-dT primers (3:1 mol ...
-
bioRxiv - Genetics 2021Quote: ... PCR products were purified with the Wizard SV Gel and PCR Clean-Up System (Promega) and quantified with a Qubit 2.0 Fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative real-time RT-PCR (qRT-PCR) was performed with the GoTaq qPCR Mastermix (Promega) using the CFX-90 real-time PCR System (Bio-Rad).
-
bioRxiv - Microbiology 2021Quote: ... PCR products were then purified using Wizard SV Gel and PCR Clean-Up System (Promega) according to the instructions by the manufacturer ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were purified by the Wizard SV Gel and PCR Clean-Up System (Promega) and quantified using the Qubit dsDNA HS assay (ThermoFisher) ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were purified with Wizard® SV Gel and PCR Clean-Up System (Promega) and ligated to the pGEM-T easy® vector (Promega) ...
-
bioRxiv - Pathology 2021Quote: ... Quantitative RT-PCR was performed by using the Go-Taq Real-Time PCR system (Promega), as previously described60 ...
-
bioRxiv - Cancer Biology 2024Quote: Quantitative real-time PCR (RT-qPCR) was performed using GoTaq PCR Master Mix (Promega, #A6002) and specific primers listed below ...
-
bioRxiv - Immunology 2023Quote: ... Quantitative real-time RT-PCR (qRT-PCR) was performed with the GoTaq qPCR Mastermix (Promega) using the CFX-90 real-time PCR System (Bio-Rad) ...