Labshake search
Citations for Promega :
151 - 200 of 1165 citations for RT qPCR Master Mixes since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... 0.2 μL GoScript™ RT Mix for 1-Step RT-qPCR (Promega, Madison, WI), 0.75 μL primer/probe sets for either N1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was diluted and qPCR performed using GoTaq qPCR Master Mix (A6002, Promega). Results are shown as means of indicated number of biological replicates (n ...
-
bioRxiv - Genetics 2019Quote: ... All qPCR reaction mixtures were prepared with the GoTaq qPCR Master Mix (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... qPCR reactions were set up with GoTaq qPCR Master Mix reagent system (Promega) and run on a StepOnePlus Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Cell Biology 2019Quote: ... using GoTaq® qPCR Master Mix (Promega, U.S.A.) according to the manufacturers’ instructions ...
-
bioRxiv - Immunology 2021Quote: ... using the GoTaq qPCR Master Mix kit (Promega). Gene expression was normalized to the housekeeping gene Rplp0 and expressed as fold change compared to CD11cWT samples ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and SYBR Green GoTaq qPCR Master Mix (Promega). Thermal cycling was conducted at 95°C for 2 min ...
-
bioRxiv - Genomics 2019Quote: ... we used the GoTaq qPCR Master Mix (Promega) at a total volume of 10 µl ...
-
bioRxiv - Genetics 2021Quote: ... with GoTaq qPCR Master Mix (Promega, Madison, WI). The fold change or percentage input of the samples was calculated using the QuantStudio™ Design & Analysis Software Version 1.2 (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... using GoTaq qPCR Master Mix (Promega, Southampton, UK). Relative gene expression was calculated using the comparative Ct method (2−δδCt)[47] ...
-
bioRxiv - Cell Biology 2021Quote: ... containing 1X GoTaq qPCR Master Mix (Promega Corporation), 300 nM CXR Reference Dye and final concentration 200nM of each SYBR green designed primers described in Supplementary Table 2 ...
-
bioRxiv - Microbiology 2021Quote: ... The GoTaq probe qPCR Master Mix (Promega, A6102) and GoTaq G2 (Promega ...
-
bioRxiv - Cell Biology 2021Quote: ... containing 1X GoTaq qPCR Master Mix (Promega Corporation), 300 nM CXR Reference Dye ...
-
bioRxiv - Physiology 2022Quote: ... with GoTaq® qPCR Master Mix (Promega, USA) and acquired with Step One software v.2.3 ...
-
bioRxiv - Neuroscience 2021Quote: ... containing 1X GoTaq qPCR Master Mix (Promega Corporation), 300 nM CXR Reference Dye ...
-
bioRxiv - Physiology 2020Quote: ... qPCR was performed using GoTaq Master Mix (Promega) and a 96 well thermal cycler (Applied Biosystems) ...
-
A critical role for heme synthesis and succinate in the regulation of pluripotent states transitionsbioRxiv - Developmental Biology 2022Quote: ... SYBR Green GoTaq qPCR Master Mix (Promega, A6002) and primers listed in the Table number 1 at a final concentration of 300 nM ...
-
bioRxiv - Microbiology 2022Quote: ... and 1X GoTaq qPCR Master Mix (Promega, A6002). Amplifications were performed using a CFX Connect Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2020Quote: ... using GoTaq Probe qPCR Master Mix (Promega, USA).
-
bioRxiv - Neuroscience 2022Quote: ... and the GoTaq® qPCR Master Mix (Promega), following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... We used the GoTaq qPCR Master Mix (Promega) with MicroAmp 0.2 mL optical strips (Applied Biosystems ...
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: ... 5 μL of GoTaq qPCR Master Mix (Promega), and 250 nM primer (Supplementary Table S2) ...
-
bioRxiv - Immunology 2023Quote: ... using the GoTaq Probe qPCR Master Mix (Promega). Primers and probes were purchased from Life Technologies (Supplemental Table 5) ...
-
Activation of XBP1s attenuates disease severity in models of proteotoxic Charcot-Marie-Tooth type 1BbioRxiv - Neuroscience 2024Quote: ... GoTaq qPCR Master Mix (Promega, Madison, WI, USA). Gene expression changes were normalised to 36B4 or Ppia gene expression by using the ΔΔCT method.
-
bioRxiv - Neuroscience 2024Quote: ... GoTaq quantitative PCR (qPCR) Master Mix (Promega; A6002) was used to conduct the qPCR ...
-
bioRxiv - Microbiology 2023Quote: The quantification of viral RNA was carried out in one-step RT-qPCR using 3 µl of the eluted RNA with the GoTaq® Probe One-step RT-qPCR System (Promega, Poland). This procedure employed in-house primers and a probe specifically tailored for the HCoV-229E N sequence ...
-
bioRxiv - Molecular Biology 2021Quote: ... the GoTaq® 1-Step RT-qPCR System (Promega) was used with the primers (F ...
-
bioRxiv - Biochemistry 2021Quote: ... and GoTaq® 1-Step RT-qPCR System (Promega) were used for RT-qPCR ...
-
bioRxiv - Microbiology 2023Quote: ... using SYBR Green GoTaq 1-Step RT-qPCR (Promega) with the SARS-CoV-2 CDC N3 primers (F – GGGAGCCTTGAATACACCAAAA ...
-
bioRxiv - Pathology 2020Quote: 0.4 µL GoScriptTM RT Mix for 1-Step RT-qPCR (Promega, Cat # A6120 and A6121)
-
bioRxiv - Pathology 2020Quote: 0.2 µL GoScriptTM RT Mix for 1-Step RT-qPCR (Promega, Cat # A6120 and A6121)
-
bioRxiv - Molecular Biology 2019Quote: ... Quantitative real-time PCR (qPCR) was carried out using GoTaq qPCR master mix (Promega) on CFX96 Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Quantitative real-time PCR (qPCR) assays were performed using GoTaq qPCR Master Mix (Promega) on a ViiA 7 Real-Time PCR System according to manufacturer’s instructions (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... mRNA levels were quantified in cDNA by qPCR with GoTaq qPCR Master Mix (Promega) according to supplier’s instructions in a Mx3000 Real-Time Thermocycler (Stratagene ...
-
bioRxiv - Molecular Biology 2020Quote: ... qPCR on cDNA or ChIP DNA was performed with GoTaq qPCR Master Mix (Promega) under the manufacturer’s instruction on a QS5 system (Thermo Scientific) ...
-
bioRxiv - Microbiology 2023Quote: qPCR was performed using the intercalating dye based GoTaq qPCR master mix kit (Promega). Briefly ...
-
bioRxiv - Developmental Biology 2023Quote: ... qPCR was performed in triplicates by using GoTaq qPCR Master Mix (Promega, WI, USA) in an Applied Biosystems 7500 Fast Real-Time PCR machine (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: Quantitative PCR: Taq qPCR was performed using SYBR Green GoTaq qPCR master mix (Promega) according to manufacturer’s instructions on a LightCycler 96 SW 1.0 (Roche Diagnostics GmbH ...
-
bioRxiv - Plant Biology 2024Quote: ... mRNA accumulation was assessed by real-time qPCR (GoTaq® qPCR Master Mix, Promega) and expression values were normalized to the expression of plant genes At4g26410 and At3g01150 as previously described as a stable reference genes (54) ...
-
bioRxiv - Plant Biology 2022Quote: ... 100 ng total DNA was added to a 20 μl PCR containing 10 μl GoTaq® Master Mixes (Promega, USA) and 0.1 μM of each primer pair ...
-
bioRxiv - Molecular Biology 2020Quote: ... in the GoTaq®qPCR Master Mix (from Promega,), before being deactivated at 95°C for 10 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... probes with GoTaq Real Time qPCR Master Mix (Promega) were used ...
-
bioRxiv - Molecular Biology 2019Quote: ... and GoTaq® qPCR Master Mix (Promega, GmbH, Germany). The relative expression of HarmGr9 was assessed (Joshi et al. ...
-
bioRxiv - Genomics 2019Quote: ... with a GoTaq® qPCR master mix kit (Promega). We used two technical replicates for each biological replicate ...
-
bioRxiv - Plant Biology 2019Quote: ... cDNA was mixed with GoTaq qPCR master mix (Promega) containing SYBR green and 300 nM of each primer ...
-
bioRxiv - Plant Biology 2021Quote: ... GoTaq® qPCR Master Mix (Promega GmbH, Mannheim, Germany) was used to carry out the qRT-PCR with oligomers as indicated in table 1 ...
-
bioRxiv - Zoology 2021Quote: ... 10μL Go-tag qPCR Master Mix (Promega, Wisconsin, USA), 0.2μL of forward primer ...
-
bioRxiv - Neuroscience 2020Quote: ... using GoTaq qPCR master mix (Promega, Madison, WI, USA) according to the manufacturer’s protocols ...
-
bioRxiv - Plant Biology 2020Quote: ... The GoTaq qPCR Master Mix Kit (Promega Corporation, USA) was used for the gene expression profiling ...
-
bioRxiv - Biophysics 2020Quote: ... 2 x GoTaq®qPCR Master Mix (Promega, Switzerland) and 1 μl cDNA ...