Labshake search
Citations for Promega :
301 - 350 of 1165 citations for RT qPCR Master Mixes since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... using the GoTaq® qPCR Master Mix kit (Promega, cat. no. A6002). The expression of HPRT1 was used as an internal control for normalization ...
-
bioRxiv - Cancer Biology 2021Quote: ... qRT-PCR was performed with GoTaq® qPCR Master Mix (Promega, USA) using an iQ5 Real-Time PCR Detection System (BioRad ...
-
bioRxiv - Cancer Biology 2020Quote: ... Real time PCR was performed with GoTaq qPCR Master Mix (A6001, Promega) using CFX Connect Detection System (1855201 ...
-
bioRxiv - Developmental Biology 2022Quote: ... qPCR was performed in technical duplicates using 2X GoTaq Master Mix (Promega) and the primers given above depending on the target transgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... in 384-well plates using the GoTaq qPCR Master Mix (A6002, Promega). Primers were designed by the Primer-BLAST tool (https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi ...
-
bioRxiv - Developmental Biology 2022Quote: ... and performed PCR with GoTaq® qPCR Master Mix (Promega, Madison, WI). PCR primers are listed in Table S1 ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA was diluted either 1:5 or 1:10 for all qPCR experiments and GoTaq qPCR Master Mix (Promega) was used to amplify cDNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... qPCR was performed on a Bio-Rad CFX96 Real-Time PCR system with the GoTaq qPCR Master Mix (Promega). Relative gene expression levels were calculated using the ΔΔCt method with CPA as the reference gene.
-
bioRxiv - Cancer Biology 2023Quote: ... qPCR reactions were set up as follows: 6.25 µl of GoTaq® qPCR Master Mix (Promega, Madison, WI, USA), 4.25 µl of nuclease-free water ...
-
bioRxiv - Molecular Biology 2023Quote: ... a qPCR was performed using 40 ng digested genomic DNA as template with the GoTaq qPCR master mix (Promega) according to manufacturer’s instruction ...
-
bioRxiv - Plant Biology 2023Quote: ... Two µl of cDNA (1:4 dilution) was added to a 20µl qPCR reaction using the GoTaq qPCR Master Mix (Promega) and ran on a BioRad CFX Opus96 thermocycler ...
-
bioRxiv - Cancer Biology 2021Quote: ... and real-time PCR using GoTaq 2-Step RT-qPCR kit (Promega, A6110). All measurements were normalized against Actin as the internal control using the 2-ΔΔCt method (Figure 1—source data 3 and Figure 3—source data 2) ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified using GoTaq® 1-Step RT-qPCR kit (Promega). SARS-CoV-2 N gene RNA was amplified using forward (Ngene F cgcaacagttcaagaaattc 28844-28864 ...
-
bioRxiv - Microbiology 2023Quote: ... GoTaq® Probe 1-Step RT-qPCR System was purchased from Promega (US). SARS-CoV-2 (2019nCoV ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was prepared by reverse transcription (GoTaq 2-Step RT-qPCR System, Promega) and amplified byPCR using SYBR® Green PCR Master Mix and ABI Prism7900HT sequence detection system (Applied Biosystems) ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was prepared by reverse transcription (GoTaq 2-Step RT-qPCR System, Promega) and amplified by PCR using SYBR® Green PCR Master Mix and ABI Prism 7900HT sequence detection system (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2023Quote: ... phosphorothioated and phosphorylated/phosphorothioated forward primers as well as a phosphorylated reverse primer were done in qPCR reaction mixtures including 1X reaction mixture of GoTaq 2-Step RT-qPCR kit (Promega, USA), 400 nM forward and reverse primers and in final volume of 20 μL ...
-
bioRxiv - Developmental Biology 2021Quote: ... Quantitative PCR (qPCR) was performed with the primers listed in Table S1 and a GoTaq qPCR Master Mix (Promega, A6002) in a Mastercycler realplex2 thermocycler (Eppendorf) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The synthesized cDNA was served as the template for qPCR and the GoTaq® qPCR Master Mix (A6001, Promega, USA) was used ...
-
bioRxiv - Developmental Biology 2023Quote: ... RT-qPCR was completed using Applied Biosystems QuantStudio3 Real-Time PCR system using GoTaq qPCR Master Mix with SYBR Green (Promega). All primers used for RT-qPCR are shown in Table S3 ...
-
bioRxiv - Neuroscience 2023Quote: ... 5-30 ng of the original RNA was used to perform qPCR for Dkk3 and Dkk1 using GoTaq qPCR Master Mix (Promega) in a CFX96 Bio-rad system following the manufacturer’s protocol (2 min at 95°C followed by 40 cycles of denaturing at 95°C and annealing/extension at 60°C) ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative real time-PCR was performed using GoTaq® qPCR Master Mix (Promega) in a QuantStudio 6 Flex thermocycler (Applied Biosystem ...
-
bioRxiv - Cancer Biology 2020Quote: SqRT-PCR was performed using the GoTaq® qPCR Master Mix (Promega, TM318), according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... qRT-PCR analysis was performed using GoTaq® qPCR Master Mix (Promega, WI) with Light Cycler 96 (Roche Life Science ...
-
bioRxiv - Molecular Biology 2020Quote: ... All the samples were analyzed in triplicate using GoTaq qPCR Master Mix (Promega) on an ABI 7300 system (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and analyzed by SYBRG real-time PCR using GoTaq qPCR Master Mix (Promega). Primers used are provided in supplementary table S3.
-
bioRxiv - Microbiology 2020Quote: ... Semi-quantitative real-time PCR was performed using GoTaq qPCR Master Mix (Promega) using primers targeting the SARS-CoV-2 E protein gene (forward primer ...
-
bioRxiv - Developmental Biology 2022Quote: ... Quantitative real time-PCR was performed using Go-Taq qPCR Master Mix (Promega) in a QuantStudio 6 Flex thermocycler (Applied Biosystem) ...
-
bioRxiv - Immunology 2022Quote: ... and GoTag®qPCR Master Mix with SYBR green fluorescence (Promega, Mannheim, Germany). PCR primer sequences were retrieved from online Primer Bank database (Spandidos et al. ...
-
bioRxiv - Immunology 2020Quote: ... Samples were analyzed by real-time PCR with GoTaq qPCR Master Mix (Promega) on the Applied Biosystem 7900HT Fast machine ...
-
bioRxiv - Cell Biology 2019Quote: ... using primers specific to individual genes and GoTaq® qPCR Master Mix (Promega). The incubation and cycling conditions were set as described in the kit and the plates were analysed in a StepOnePlus Real-Time PCR System (Thermo Scientific).
-
bioRxiv - Developmental Biology 2019Quote: ... amplification reactions (10 μl) prepared with the GoTaq Probe qPCR Master Mix (Promega) were run in a StepOnePlus Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... Real time-polymerase chain reactions were performed with GoTaq qPCR Master Mix (Promega) according to the manufacturer’s instructions and completed on QuantStudio 6 Flex system (ABI) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Quantitative PCR was performed using the GoTaq qPCR master mix 2x (Promega, #A6001) with a Bio-Rad CFX384 Real-Time thermal cycler ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA was amplified using GoTaq Probe qPCR Master Mix (Promega, Leiden, the Netherlands) and TaqMan Gene Expression Assay (Thermo Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... The reactions were up in triplicate with the GoTaq qPCR Master Mix (Promega) and run on AriaMx Real-time PCR (Agilent) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and analysed by SYBRG real-time PCR using GoTaq qPCR Master Mix (Promega). Primers used are provided in supplementary Table S2.
-
bioRxiv - Microbiology 2023Quote: ... Real time quantitative PCR was performed using GoTaq qPCR Master mix kit (Promega) in a CFX Connect Real-Time PCR thermocycler (BioRad) ...
-
bioRxiv - Neuroscience 2023Quote: ... and accompanying BioRad CFX Manager (v3.1) using GoTaq qPCR master mix (Promega, A6001) with the primers qPCR_appb_F2 (5’-CGTGGTCATCGCTACTGTCA ...
-
bioRxiv - Molecular Biology 2023Quote: QRT-PCR was performed using the GoTaq qPCR Master Mix (Promega, Cat# A6002) on a QuantStudio 5 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... USA) and 10 μl of GoTaq 1-Step RT-qPCR (Promega, Madison, WI, USA). Thermal cycling was performed at 50°C for 15min for reverse transcription ...
-
bioRxiv - Microbiology 2022Quote: ... Reactions were performed with the GoTaq® Probe 1-Step RT-qPCR System (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and the 200 nM GoTaq® Probe 1-Step RT-qPCR System Kit (Promega). This kit uses GoTaq Probe qPCR Master Mix with dUTP (10 uL) ...
-
bioRxiv - Cancer Biology 2022Quote: ... qPCRs were carried out by loading the same volume of DNA per sample and using GoTaq® qPCR Master Mix (Promega). Details of human-specific primers used are available in supplementary table S3.
-
bioRxiv - Developmental Biology 2021Quote: ... The samples were resuspended in 30 uL of TE buffer and amplified by qPCR using GoTag qPCR Master Mix (Promega #A6001), using as amplicons the p53RE for the rpr and hid genes ...
-
bioRxiv - Molecular Biology 2020Quote: ... EPOP and Ser5-RNAPII and quality control of all immunoprecipitated DNA samples were tested by qPCR using GoTaq® qPCR Master Mix (Promega) with a QuantStudio 6 Flex Real-time PCR System (Applied Biosystems) ...
-
Phosphoproteomics of cellular mechanosensing reveals NFATC4 as a regulator of myofibroblast activitybioRxiv - Systems Biology 2023Quote: ... Quantitative PCR (qPCR) was then performed on LightCycler 480 Real-Time PCR System using the GoTaq qPCR Master Mix (Promega, #A6001), and the primers pairs are listed in Table S7 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 20 ng of cDNA of each sample was used for the qPCR reaction (duplicate/sample) with ENG or α-tubulin specific primers (Supp. Table 1) and the GoTaq qPCR Master mix (Promega), in presence of CXR reference dye ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... RT-PCR was carried out using SYBR Green master mix (Sybr Green-A6001 Promega) for detection in Light cycler LC 480 (Roche) ...
-
bioRxiv - Cell Biology 2020Quote: ... Relative expression of genes was quantified using GoTaq® qPCR Master Mix (Promega, A6001) and analyzed according to the 2−ΔΔCt method (Livak and Schmittgen ...