Labshake search
Citations for Promega :
101 - 150 of 1236 citations for RT qPCR Master Mixes since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Quantitative Comparison of Presenilin Protein Expression Reveals Greater Activity of PS2-γ-SecretasebioRxiv - Cell Biology 2023Quote: ... GoTaq qPCR master mix (Promega A6001) was used in a final reaction volume of 20 µl ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and GoTaq qPCR Master Mix (Promega). Reaction conditions were 50°C for 2 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... AePer50 reverse transcription (RT) and qPCR reactions were performed using GoTaq® 1-Step RT-qPCR System (Promega), with 10 µl of 2X qPCR Master Mix ...
-
bioRxiv - Cell Biology 2021Quote: ... Viral RNA was detected using the CDC 2019-Novel Coronavirus Real-Time RT-PCR Diagnostic Panel as per Centre for Disease and Control’s optimised protocol (Integrated DNA Technologies) for use with Go-Taq 1-step RT-qPCR Master Mix (Promega). Gene expression profile and SARS-CoV-2 N subgenomic RNA expression were determined with a standard qPCR cycle (50°C for 2 minutes ...
-
bioRxiv - Pathology 2023Quote: ... USA) using SYBR Green PCR or TaqMan Universal PCR master mixes (Go Taq Probe PCR Master Mix; Promega, A600A or A610A, respectively). The following TaqMan probes were used ...
-
bioRxiv - Microbiology 2020Quote: ... GoTaq 1-Step RT-qPCR kit (Promega) was used at a final volume of 20 μl with ...
-
bioRxiv - Plant Biology 2021Quote: ... A One-step RT-qPCR kit (Promega) was used for converting the RNA into cDNA before amplifying target transcripts on a CFX Connect Real-Time PCR Detection System (Biorad) ...
-
bioRxiv - Pathology 2020Quote: ... using GoTaq 1-Step RT-qPCR (Promega) with the SARS-CoV-2 CDC N3 primers (F – GGGAGCCTTGAATACACCAAAA ...
-
bioRxiv - Molecular Biology 2020Quote: ... qPCRs were performed using GoTaq® Probe qPCR Master Mix (Promega) or TaqMan® Fast Advanced Master Mix (Thermo Fisher).
-
bioRxiv - Cell Biology 2020Quote: ... qPCR was performed using GoTaq qPCR Master Mix (Promega, WI, USA) with StepOne Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR was performed using GoTaq qPCR Master Mix (Promega, WI, USA) with the StepOne Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR was performed using GoTaq qPCR Master Mix (Promega, WI, USA) with the StepOne Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2021Quote: ... and qPCR was performed using qPCR SYBR Master Mix (Promega; A6001). Quantitative PCR was performed with QuantStudio3 (Applied Biosystems ...
-
bioRxiv - Plant Biology 2021Quote: ... qPCR was done with the GoTaq® qPCR Master Mix (Promega). For technical repeats ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR was performed using GoTaq qPCR Master Mix (Promega, WI, USA) with the StepOne Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: ... qPCR was performed using GoTaq qPCR Master Mix (Promega, Cat# A6102) on CFX96 thermal cycler (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2022Quote: ... qPCR was performed using GoTaq qPCR Master Mix (Promega, Cat# A6102) on CFX96 thermal cycler (Bio-Rad) ...
-
bioRxiv - Physiology 2020Quote: ... qPCR was performed using a GoTaq qPCR Master Mix (Promega, USA) and primers listed in Supplementary Table 1 using a Step One Plus (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2019Quote: ... qPCR was performed using GoTaq® qPCR Master Mix (A6001, Promega). Primer sequences are listed in Table S1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... qPCR was performed using GoTaq qPCR Master Mix (Promega, Cat# A6102) on CFX96 thermal cycler (Bio-Rad) ...
-
bioRxiv - Cell Biology 2020Quote: ... qPCR was performed using GoTaq qPCR Master Mix (Promega, WI, USA) with StepOne Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR was performed using GoTaq qPCR Master Mix (Promega, WI, USA) with StepOne Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative PCR (qPCR) was performed using GoTaq qPCR Master Mix (Promega). The primers used for Lrp6 were ...
-
bioRxiv - Molecular Biology 2023Quote: ... qPCR was performed with the GoTaq qPCR Master Mix (Promega, #A6001) on a Quantstudio 3 Real-Time PCR System (ThermoFisher Scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The GoTaq® qPCR and RT-qPCR Systems kit (Promega, Beijing, China) was used to quantify the transcript abundance on the ABI 7500 real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Immunology 2021Quote: ... RT-qPCR to detect ZIKV was performed in a 20 μL reaction final volume containing GoTaq one-step RT-qPCR master mix (Promega), 25 ng of sample RNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... and real-time polymerase chain reaction (RT-PCR) conducted using the Techne Prime Pro thermal cycler with GoTaq qPCR Master Mix (Promega). RT-qPCR reactions were carried out in 10 μL volumes containing 3.5 mM MgCl2 ...
-
bioRxiv - Developmental Biology 2019Quote: ... cells into micro-tubes containing 5 µl of cold 1X SuperScript IV VILO Master Mix for two-step RT-qPCR containing 6 units RNasin (Promega) and 0.5% (v/v ...
-
bioRxiv - Microbiology 2019Quote: ... using the GoTaq qPCR Master Mix (Promega). Each reaction was run with two technical replicates ...
-
bioRxiv - Developmental Biology 2019Quote: ... using the GoTaq qPCR Master Mix (Promega). Each RT-qPCR was carried out with at least two biological replicates and ΔCt were computed using the house-keeping gene Rps9 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and GoTaq Probe qPCR Master Mix (Promega) according to manufacturers’ protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... The GoTaq® qPCR Master Mix (Promega) was used according to manufacturer’s instructions and the samples were run in triplicate on the AriaMx Real-time PCR System (Agilent) ...
-
bioRxiv - Cancer Biology 2022Quote: ... GoTaq qPCR Master Mix kit (Promega #A6001) and specific primers were used to set up the quantitative real-time PCR (qPCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... and GoTaq® qPCR Master Mix (Promega). Two references were used for normalization and the fold induction of mRNA of the target of interest was calculated compared to the control sample using the ΔΔCq method ...
-
bioRxiv - Microbiology 2023Quote: ... and 2× GoTaq qPCR Master Mix (Promega). qPCR was performed using the MyGo Pro real-time PCR instrument (IT-IS Life Science Ltd.) ...
-
bioRxiv - Microbiology 2023Quote: ... using GoTaq® qPCR Master Mix (Promega). Analyses were performed following the manufactureŕs protocol using gene-specific qPCR primers ...
-
bioRxiv - Developmental Biology 2024Quote: ... GoTaq qPCR master mix (Promega, Wisconsin, USA) and qTOWER3 G (Analytik Jena ...
-
bioRxiv - Systems Biology 2024Quote: ... 12.5 μl GoTaq qPCR Master Mix (Promega), 9.3 μl nuclease-free H2O and 1 μl of each of the corresponding sense and antisense primers (10 pmol/μl) ...
-
bioRxiv - Microbiology 2021Quote: ... A series of concentrations from 50-600nM in symmetric and asymmetric forward and reverse primer concentrations were added to the RT-qPCR reaction using the GoTaq 1-Step RT-qPCR System (Promega) according to the manufacturer’s instructions using the standard annealing temperature of 60°C ...
-
bioRxiv - Microbiology 2020Quote: RT-qPCR analyses of NoV GII were carried out using GoTaq® Probe 1-Step RT-qPCR System (Promega, USA). Primers and the FAM/TAMRA-labelled probe of NoV GII were according to ISO 15216-1:2017 ...
-
bioRxiv - Microbiology 2022Quote: RT-qPCR analyses of NoV GII were carried out using GoTaq® Probe 1-Step RT-qPCR System (Promega, USA). Primers and the FAM/TAMRA-labelled probe of hNoV GII were according to ISO 15216-1:2017 ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR was performed in triplicate with the GoTaq qPCR Master Mix (Promega) in a LightCycler 480 instrument (Roche ...
-
bioRxiv - Cell Biology 2022Quote: ... QPCR was performed with GoTaq® qPCR Master Mix (Promega, Madison, WI). QPCR primers sequence will be provided upon request ...
-
bioRxiv - Microbiology 2019Quote: ... qPCR was performed using a GoTaq qPCR Master Mix kit (Promega, WI) and a QuantStudio 3 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Genomics 2021Quote: ... qPCR was done with GoTaq® qPCR Master Mix (Promega ref: A602) on ViiA 7 Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... qPCR was performed using GoTaq qPCR Master Mix (Promega, Madison, WI, USA) with the StepOne Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... qPCR was performed using GoTaq qPCR Master Mix (Promega, Madison, WI, USA) with StepOne Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2023Quote: ... Quantitative PCRs (qPCRs) were performed with GoTaq ® qPCR Master mix (Promega) following the standard cycling conditions suggested by the manufacturer in a StepOnePlus real time PCR system (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... qPCR was performed using GoTaq qPCR Master Mix (Promega, Madison, WI, USA) with StepOne Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2023Quote: ... and qPCR was performed with the Gotaq qPCR master mix (A6001, Promega) and the CFX96 Touch Real-Time PCR Detection System (Biorad) ...